EMAIL THIS PAGE TO A FRIEND

EVI5L

ecotropic viral integration site 5-like

UniProtKB ID: Q96CN4, B9A6I9
Gene ID:
Mouse(213027) ecotropic viral integration site 5 like
Rat(304201) ecotropic viral integration site 5-like
chicken(430998) ecotropic viral integration site 5-like
dog(485001) ecotropic viral integration site 5-like
Horse(100147518) ecotropic viral integration site 5-like
cow(536625) ecotropic viral integration site 5-like
domestic cat(101100948) ecotropic viral integration site 5-like
sheep(101102563) ecotropic viral integration site 5-like
naked mole-rat(101707688) ecotropic viral integration site 5-like
domestic guinea pig(100735135) ecotropic viral integration site 5-like
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145245 Rosetta Predictions human pricing
XM_221812 Rosetta Predictions rat pricing
XR_008219 Rosetta Predictions rat pricing
NM_001039578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023012 predicted 458
2 SASI_Hs02_00365086 predicted 2851
3 SASI_Hs01_00023013 predicted 550
4 SASI_Hs01_00023014 predicted 1117
5 SASI_Hs01_00023015 predicted 1904
6 SASI_Hs01_00023016 predicted 1297
7 SASI_Hs01_00023017 predicted 2427
8 SASI_Hs01_00023018 predicted 2107
9 SASI_Hs01_00023019 predicted 2394
10 SASI_Hs01_00023020 predicted 1113
11 SASI_Hs01_00023011 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00127974 predicted 1859
2 SASI_Rn01_00127975 predicted 886
3 SASI_Rn01_00127976 predicted 581
4 SASI_Rn01_00127977 predicted 750
5 SASI_Rn01_00127978 predicted 296
6 SASI_Rn01_00127979 predicted 495
7 SASI_Rn01_00127980 predicted 803
8 SASI_Rn01_00127981 predicted 1017
9 SASI_Rn01_00127982 predicted 1927
10 SASI_Rn01_00127983 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_008219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00163273 predicted 3052
2 SASI_Rn02_00416509 predicted 1049
3 SASI_Rn01_00163274 predicted 1114
4 SASI_Rn01_00163275 predicted 1288
5 SASI_Rn01_00163276 predicted 529
6 SASI_Rn01_00163277 predicted 1041
7 SASI_Rn01_00163279 predicted 3441
8 SASI_Rn01_00163280 predicted 2294
9 SASI_Rn02_00416510 predicted 3293
10 SASI_Rn01_00163281 predicted 2664
11 SASI_Rn01_00163278 predicted 3086
12 SASI_Rn01_00163282 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020067 predicted 1286
2 SASI_Mm02_00290163 predicted 1187
3 SASI_Mm01_00020069 predicted 1340
4 SASI_Mm01_00020068 predicted 1419
5 SASI_Mm01_00020070 predicted 1918
6 SASI_Mm01_00020071 predicted 704
7 SASI_Mm01_00020072 predicted 1336
8 SASI_Mm01_00020073 predicted 1587
9 SASI_Mm02_00290164 predicted 2752
10 SASI_Mm01_00020074 predicted 973
11 SASI_Mm01_00020075 predicted 1910
12 SASI_Mm01_00020076 predicted 1483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153536
EVI5L MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 5-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-614s1c1
Sequence:CCGGGCCACAGATATGCCCGTCAAACTCGAGTTTGACGGGCATATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153536.2-3465s1c1
Sequence:CCGGGCTGCAAAGAAGAAACCCTTTCTCGAGAAAGGGTTTCTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-710s1c1
Sequence:CCGGCCAGAGCATGAATTCTTCAAACTCGAGTTTGAAGAATTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-289s1c1
Sequence:CCGGCCCAACCTCTGACTCCGAGAACTCGAGTTCTCGGAGTCAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-1277s1c1
Sequence:CCGGCAGGTCAAGTACAACCCTAAACTCGAGTTTAGGGTTGTACTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153536
EVI5L MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 5-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-614s1c1
Sequence:CCGGGCCACAGATATGCCCGTCAAACTCGAGTTTGACGGGCATATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153536.2-3465s1c1
Sequence:CCGGGCTGCAAAGAAGAAACCCTTTCTCGAGAAAGGGTTTCTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-710s1c1
Sequence:CCGGCCAGAGCATGAATTCTTCAAACTCGAGTTTGAAGAATTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-289s1c1
Sequence:CCGGCCCAACCTCTGACTCCGAGAACTCGAGTTCTCGGAGTCAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-1277s1c1
Sequence:CCGGCAGGTCAAGTACAACCCTAAACTCGAGTTTAGGGTTGTACTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153536
EVI5L MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 5-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-614s1c1
Sequence:CCGGGCCACAGATATGCCCGTCAAACTCGAGTTTGACGGGCATATCTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153536.2-3465s1c1
Sequence:CCGGGCTGCAAAGAAGAAACCCTTTCTCGAGAAAGGGTTTCTTCTTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-710s1c1
Sequence:CCGGCCAGAGCATGAATTCTTCAAACTCGAGTTTGAAGAATTCATGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-289s1c1
Sequence:CCGGCCCAACCTCTGACTCCGAGAACTCGAGTTCTCGGAGTCAGAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153536.2-1277s1c1
Sequence:CCGGCAGGTCAAGTACAACCCTAAACTCGAGTTTAGGGTTGTACTTGACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145245
EVI5L MISSION shRNA Bacterial Glycerol Stock
ecotropic viral integration site 5-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-861s1c1
Sequence:CCGGCCAAAGCTTCCACACATCCATCTCGAGATGGATGTGTGGAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1198s1c1
Sequence:CCGGGAGGAGCAGATCGAGATCAAACTCGAGTTTGATCTCGATCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1146s1c1
Sequence:CCGGGAAGATGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145245.2-3263s1c1
Sequence:CCGGCTTCCCTTTCTTCATGTGTTTCTCGAGAAACACATGAAGAAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-798s1c1
Sequence:CCGGCATCTATCAGTTCGAGTACATCTCGAGATGTACTCGAACTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-942s1c1
Sequence:CCGGCCGGGTCTTTGACATCTTCATCTCGAGATGAAGATGTCAAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1251s1c1
Sequence:CCGGGCGGATTGAAACCCTAGAGAACTCGAGTTCTCTAGGGTTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1116s1c1
Sequence:CCGGCAAAGCCTACCAGGTCAAGTACTCGAGTACTTGACCTGGTAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-2199s21c1
Sequence:CCGGACTCGGACTCATCGCAGTACACTCGAGTGTACTGCGATGAGTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-948s21c1
Sequence:CCGGGCTTCCACACATCCATGTATGCTCGAGCATACATGGATGTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145245
EVI5L MISSION shRNA shRNA Plasmid DNA
ecotropic viral integration site 5-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-861s1c1
Sequence:CCGGCCAAAGCTTCCACACATCCATCTCGAGATGGATGTGTGGAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1198s1c1
Sequence:CCGGGAGGAGCAGATCGAGATCAAACTCGAGTTTGATCTCGATCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1146s1c1
Sequence:CCGGGAAGATGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145245.2-3263s1c1
Sequence:CCGGCTTCCCTTTCTTCATGTGTTTCTCGAGAAACACATGAAGAAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-798s1c1
Sequence:CCGGCATCTATCAGTTCGAGTACATCTCGAGATGTACTCGAACTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-942s1c1
Sequence:CCGGCCGGGTCTTTGACATCTTCATCTCGAGATGAAGATGTCAAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1251s1c1
Sequence:CCGGGCGGATTGAAACCCTAGAGAACTCGAGTTCTCTAGGGTTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1116s1c1
Sequence:CCGGCAAAGCCTACCAGGTCAAGTACTCGAGTACTTGACCTGGTAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-2199s21c1
Sequence:CCGGACTCGGACTCATCGCAGTACACTCGAGTGTACTGCGATGAGTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-948s21c1
Sequence:CCGGGCTTCCACACATCCATGTATGCTCGAGCATACATGGATGTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145245
EVI5L MISSION shRNA Lentiviral Transduction Particles
ecotropic viral integration site 5-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156127    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-861s1c1
Sequence:CCGGCCAAAGCTTCCACACATCCATCTCGAGATGGATGTGTGGAAGCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155315    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1198s1c1
Sequence:CCGGGAGGAGCAGATCGAGATCAAACTCGAGTTTGATCTCGATCTGCTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145245.2-1146s1c1
Sequence:CCGGGAAGATGAAGAGGCTGGAGAACTCGAGTTCTCCAGCCTCTTCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151878    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145245.2-3263s1c1
Sequence:CCGGCTTCCCTTTCTTCATGTGTTTCTCGAGAAACACATGAAGAAAGGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-798s1c1
Sequence:CCGGCATCTATCAGTTCGAGTACATCTCGAGATGTACTCGAACTGATAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-942s1c1
Sequence:CCGGCCGGGTCTTTGACATCTTCATCTCGAGATGAAGATGTCAAAGACCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1251s1c1
Sequence:CCGGGCGGATTGAAACCCTAGAGAACTCGAGTTCTCTAGGGTTTCAATCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155596    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145245.2-1116s1c1
Sequence:CCGGCAAAGCCTACCAGGTCAAGTACTCGAGTACTTGACCTGGTAGGCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-2199s21c1
Sequence:CCGGACTCGGACTCATCGCAGTACACTCGAGTGTACTGCGATGAGTCCGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145245.3-948s21c1
Sequence:CCGGGCTTCCACACATCCATGTATGCTCGAGCATACATGGATGTGTGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks