EMAIL THIS PAGE TO A FRIEND

EVL

Enah/Vasp-like

77 Gene Product Result for
Synonyms: RNB6
Gene ID:
Mouse(14026) Ena-vasodilator stimulated phosphoprotein
Rat(79115) Enah/Vasp-like
naked mole-rat(101706785) Enah/Vasp-like
chicken(423453) Enah/Vasp-like
cow(506201) Enah/Vasp-like
domestic cat(101080297) Enah/Vasp-like
dog(480433) Enah/Vasp-like
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016337 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016337 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016337 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007965 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007965 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007965 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU036661 MISSION® esiRNA esiRNA human EVL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016337 Rosetta Predictions human pricing
NM_024147 Rosetta Predictions rat pricing
XM_579484 Rosetta Predictions rat pricing
NM_007965 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170055 predicted 263
2 SASI_Hs01_00170056 predicted 247
3 SASI_Hs01_00170057 predicted 332
4 SASI_Hs01_00170058 predicted 1477
5 SASI_Hs01_00170059 predicted 244
6 SASI_Hs01_00170060 predicted 281
7 SASI_Hs01_00170061 predicted 1468
8 SASI_Hs01_00170062 predicted 1524
9 SASI_Hs01_00170063 predicted 408
10 SASI_Hs01_00170064 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085497 predicted 305
2 SASI_Rn01_00085498 predicted 332
3 SASI_Rn01_00085499 predicted 1601
4 SASI_Rn02_00263874 predicted 1552
5 SASI_Rn01_00085501 predicted 468
6 SASI_Rn01_00085503 predicted 307
7 SASI_Rn01_00085504 predicted 481
8 SASI_Rn02_00263875 predicted 412
9 SASI_Rn01_00085506 predicted 1278
10 SASI_Rn02_00263876 predicted 1461
11 SASI_Rn01_00085500 predicted 1599
12 SASI_Rn01_00085502 predicted 323
13 SASI_Rn01_00085505 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579484 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00136124 predicted 1048
2 SASI_Rn01_00136125 predicted 1053
3 SASI_Rn01_00136126 predicted 924
4 SASI_Rn01_00136127 predicted 856
5 SASI_Rn01_00136128 predicted 1051
6 SASI_Rn01_00136129 predicted 1054
7 SASI_Rn01_00136130 predicted 848
8 SASI_Rn01_00136131 predicted 963
9 SASI_Rn01_00136132 predicted 1006
10 SASI_Rn01_00136133 predicted 1049
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007965 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123782 predicted 588
2 SASI_Mm01_00123783 predicted 745
3 SASI_Mm01_00123784 predicted 578
4 SASI_Mm01_00123785 predicted 547
5 SASI_Mm01_00123786 predicted 525
6 SASI_Mm01_00123787 predicted 1465
7 SASI_Mm01_00123788 predicted 1462
8 SASI_Mm01_00123789 predicted 724
9 SASI_Mm01_00123790 predicted 1485
10 SASI_Mm01_00123791 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016337
VALIDATED
EVL MISSION shRNA Bacterial Glycerol Stock
Enah/Vasp-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-140s21c1
Sequence:CCGGACGATGACACCAGTAAGAAATCTCGAGATTTCTTACTGGTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1550s21c1
Sequence:CCGGACACCAGGTCTGCTCGTCTTTCTCGAGAAAGACGAGCAGACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1100s21c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-357s21c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-980s21c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016337.2-195s1c1
Sequence:CCGGCCGGATCAACATCTACCACAACTCGAGTTGTGGTAGATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-980s1c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1626s1c1
Sequence:CCGGCCCTAAGTCACCTGCTTCATTCTCGAGAATGAAGCAGGTGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-357s1c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1100s1c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016337
VALIDATED
EVL MISSION shRNA shRNA Plasmid DNA
Enah/Vasp-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-140s21c1
Sequence:CCGGACGATGACACCAGTAAGAAATCTCGAGATTTCTTACTGGTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1550s21c1
Sequence:CCGGACACCAGGTCTGCTCGTCTTTCTCGAGAAAGACGAGCAGACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1100s21c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-357s21c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-980s21c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016337.2-195s1c1
Sequence:CCGGCCGGATCAACATCTACCACAACTCGAGTTGTGGTAGATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-980s1c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1626s1c1
Sequence:CCGGCCCTAAGTCACCTGCTTCATTCTCGAGAATGAAGCAGGTGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-357s1c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1100s1c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016337
VALIDATED
EVL MISSION shRNA Lentiviral Transduction Particles
Enah/Vasp-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-140s21c1
Sequence:CCGGACGATGACACCAGTAAGAAATCTCGAGATTTCTTACTGGTGTCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294298    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1550s21c1
Sequence:CCGGACACCAGGTCTGCTCGTCTTTCTCGAGAAAGACGAGCAGACCTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-1100s21c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-357s21c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016337.2-980s21c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016337.2-195s1c1
Sequence:CCGGCCGGATCAACATCTACCACAACTCGAGTTGTGGTAGATGTTGATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-980s1c1
Sequence:CCGGGCCAAATGGAAGATCCTAGTACTCGAGTACTAGGATCTTCCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063868    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1626s1c1
Sequence:CCGGCCCTAAGTCACCTGCTTCATTCTCGAGAATGAAGCAGGTGACTTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-357s1c1
Sequence:CCGGCGGCTTAAACTTTGCAAGTAACTCGAGTTACTTGCAAAGTTTAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016337.2-1100s1c1
Sequence:CCGGTGTCCTCGATTCTGTCCAGAACTCGAGTTCTGGACAGAATCGAGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007965
VALIDATED
EVL MISSION shRNA Bacterial Glycerol Stock
Enah/Vasp-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007965.2-1919s1c1
Sequence:CCGGGCTTTATTAGATGGCTTCCAACTCGAGTTGGAAGCCATCTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-739s1c1
Sequence:CCGGGCCCGTCAGGTCTATGGCTTACTCGAGTAAGCCATAGACCTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007965.2-541s1c1
Sequence:CCGGGACACCAGTAAGAAGTGGGTACTCGAGTACCCACTTCTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-1281s1c1
Sequence:CCGGCCTCATGGAAGAAATGAACAACTCGAGTTGTTCATTTCTTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-741s1c1
Sequence:CCGGCCGTCAGGTCTATGGCTTAAACTCGAGTTTAAGCCATAGACCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007965
VALIDATED
EVL MISSION shRNA shRNA Plasmid DNA
Enah/Vasp-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007965.2-1919s1c1
Sequence:CCGGGCTTTATTAGATGGCTTCCAACTCGAGTTGGAAGCCATCTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-739s1c1
Sequence:CCGGGCCCGTCAGGTCTATGGCTTACTCGAGTAAGCCATAGACCTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007965.2-541s1c1
Sequence:CCGGGACACCAGTAAGAAGTGGGTACTCGAGTACCCACTTCTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-1281s1c1
Sequence:CCGGCCTCATGGAAGAAATGAACAACTCGAGTTGTTCATTTCTTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-741s1c1
Sequence:CCGGCCGTCAGGTCTATGGCTTAAACTCGAGTTTAAGCCATAGACCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007965
VALIDATED
EVL MISSION shRNA Lentiviral Transduction Particles
Enah/Vasp-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091073    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007965.2-1919s1c1
Sequence:CCGGGCTTTATTAGATGGCTTCCAACTCGAGTTGGAAGCCATCTAATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-739s1c1
Sequence:CCGGGCCCGTCAGGTCTATGGCTTACTCGAGTAAGCCATAGACCTGACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007965.2-541s1c1
Sequence:CCGGGACACCAGTAAGAAGTGGGTACTCGAGTACCCACTTCTTACTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-1281s1c1
Sequence:CCGGCCTCATGGAAGAAATGAACAACTCGAGTTGTTCATTTCTTCCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007965.2-741s1c1
Sequence:CCGGCCGTCAGGTCTATGGCTTAAACTCGAGTTTAAGCCATAGACCTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks