EMAIL THIS PAGE TO A FRIEND

EVPL

envoplakin

48 Gene Product Result for
Synonyms: EVPK
UniProtKB ID: Q92817, A0AUV5
Gene ID:
Mouse(14027) envoplakin
Rat(303687) envoplakin
chicken(427805) envoplakin
Horse(100051395) envoplakin
cow(510502) envoplakin
dog(483324) envoplakin
sheep(101118371) envoplakin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053969 Anti-EVPL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_283024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_283024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_283024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001988 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001988 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001988 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030751 MISSION® esiRNA esiRNA human EVPL (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001988 Rosetta Predictions human pricing
NM_001107066 Rosetta Predictions rat pricing
NM_025276 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001988 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098172 predicted 5727
2 SASI_Hs01_00098173 predicted 1188
3 SASI_Hs01_00098174 predicted 4732
4 SASI_Hs01_00098175 predicted 5714
5 SASI_Hs01_00098176 predicted 4723
6 SASI_Hs01_00098177 predicted 4782
7 SASI_Hs01_00098178 predicted 5728
8 SASI_Hs01_00098179 predicted 5501
9 SASI_Hs01_00098181 predicted 756
10 SASI_Hs02_00332974 predicted 5548
11 SASI_Hs01_00098180 predicted 4579
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225156 predicted 5481
2 SASI_Rn02_00225157 predicted 1838
3 SASI_Rn02_00225158 predicted 5064
4 SASI_Rn02_00225159 predicted 5581
5 SASI_Rn02_00225160 predicted 4427
6 SASI_Rn02_00225161 predicted 5396
7 SASI_Rn02_00225162 predicted 402
8 SASI_Rn02_00225163 predicted 4281
9 SASI_Rn02_00225164 predicted 791
10 SASI_Rn02_00225165 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039374 predicted 5770
2 SASI_Mm02_00327882 predicted 5583
3 SASI_Mm01_00039375 predicted 703
4 SASI_Mm01_00039376 predicted 4024
5 SASI_Mm01_00039378 predicted 3141
6 SASI_Mm01_00039379 predicted 5600
7 SASI_Mm01_00039382 predicted 5175
8 SASI_Mm02_00327883 predicted 884
9 SASI_Mm02_00327884 predicted 1922
10 SASI_Mm01_00039383 predicted 5589
11 SASI_Mm01_00039377 predicted 5494
12 SASI_Mm01_00039380 predicted 2518
13 SASI_Mm01_00039381 predicted 5425
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_283024
EVPL MISSION shRNA Bacterial Glycerol Stock
envoplakin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-1260s1c1
Sequence:CCGGGCGGTACACACTCAAGGATAACTCGAGTTATCCTTGAGTGTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-555s1c1
Sequence:CCGGGCAGAGAGAAATCGAGGCTTACTCGAGTAAGCCTCGATTTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2528s1c1
Sequence:CCGGCGAAGAGACTCAGAGTGATTTCTCGAGAAATCACTCTGAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-5514s1c1
Sequence:CCGGAGACAACAAGTGTAGCATCAACTCGAGTTGATGCTACACTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2320s1c1
Sequence:CCGGGCACAGAAGAGACTGATACAACTCGAGTTGTATCAGTCTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_283024
EVPL MISSION shRNA shRNA Plasmid DNA
envoplakin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-1260s1c1
Sequence:CCGGGCGGTACACACTCAAGGATAACTCGAGTTATCCTTGAGTGTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-555s1c1
Sequence:CCGGGCAGAGAGAAATCGAGGCTTACTCGAGTAAGCCTCGATTTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2528s1c1
Sequence:CCGGCGAAGAGACTCAGAGTGATTTCTCGAGAAATCACTCTGAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-5514s1c1
Sequence:CCGGAGACAACAAGTGTAGCATCAACTCGAGTTGATGCTACACTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2320s1c1
Sequence:CCGGGCACAGAAGAGACTGATACAACTCGAGTTGTATCAGTCTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_283024
EVPL MISSION shRNA Lentiviral Transduction Particles
envoplakin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-1260s1c1
Sequence:CCGGGCGGTACACACTCAAGGATAACTCGAGTTATCCTTGAGTGTGTACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-555s1c1
Sequence:CCGGGCAGAGAGAAATCGAGGCTTACTCGAGTAAGCCTCGATTTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2528s1c1
Sequence:CCGGCGAAGAGACTCAGAGTGATTTCTCGAGAAATCACTCTGAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-5514s1c1
Sequence:CCGGAGACAACAAGTGTAGCATCAACTCGAGTTGATGCTACACTTGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_283024.2-2320s1c1
Sequence:CCGGGCACAGAAGAGACTGATACAACTCGAGTTGTATCAGTCTCTTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001988
EVPL MISSION shRNA Bacterial Glycerol Stock
envoplakin
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001988.1-6299s1c1
Sequence:CCGGCCCTCTGTCCAACCACTGTTTCTCGAGAAACAGTGGTTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-4640s1c1
Sequence:CCGGGCAGGAGAAGACCATCTACAACTCGAGTTGTAGATGGTCTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-3320s1c1
Sequence:CCGGCGTGGTGAAAGAGGTAGTCAACTCGAGTTGACTACCTCTTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1402s1c1
Sequence:CCGGAGCGGTATAAGCTGGTAGATACTCGAGTATCTACCAGCTTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1403s1c1
Sequence:CCGGGCGGTATAAGCTGGTAGATAACTCGAGTTATCTACCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-5593s21c1
Sequence:CCGGTCACTCTCCATCGGCTCTATCCTCGAGGATAGAGCCGATGGAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-2802s21c1
Sequence:CCGGGAACCTTGCAAAGGCCTATACCTCGAGGTATAGGCCTTTGCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001988
EVPL MISSION shRNA shRNA Plasmid DNA
envoplakin
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001988.1-6299s1c1
Sequence:CCGGCCCTCTGTCCAACCACTGTTTCTCGAGAAACAGTGGTTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-4640s1c1
Sequence:CCGGGCAGGAGAAGACCATCTACAACTCGAGTTGTAGATGGTCTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-3320s1c1
Sequence:CCGGCGTGGTGAAAGAGGTAGTCAACTCGAGTTGACTACCTCTTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1402s1c1
Sequence:CCGGAGCGGTATAAGCTGGTAGATACTCGAGTATCTACCAGCTTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1403s1c1
Sequence:CCGGGCGGTATAAGCTGGTAGATAACTCGAGTTATCTACCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-5593s21c1
Sequence:CCGGTCACTCTCCATCGGCTCTATCCTCGAGGATAGAGCCGATGGAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-2802s21c1
Sequence:CCGGGAACCTTGCAAAGGCCTATACCTCGAGGTATAGGCCTTTGCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001988
EVPL MISSION shRNA Lentiviral Transduction Particles
envoplakin
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113796    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001988.1-6299s1c1
Sequence:CCGGCCCTCTGTCCAACCACTGTTTCTCGAGAAACAGTGGTTGGACAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-4640s1c1
Sequence:CCGGGCAGGAGAAGACCATCTACAACTCGAGTTGTAGATGGTCTTCTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-3320s1c1
Sequence:CCGGCGTGGTGAAAGAGGTAGTCAACTCGAGTTGACTACCTCTTTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1402s1c1
Sequence:CCGGAGCGGTATAAGCTGGTAGATACTCGAGTATCTACCAGCTTATACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001988.1-1403s1c1
Sequence:CCGGGCGGTATAAGCTGGTAGATAACTCGAGTTATCTACCAGCTTATACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-5593s21c1
Sequence:CCGGTCACTCTCCATCGGCTCTATCCTCGAGGATAGAGCCGATGGAGAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001988.2-2802s21c1
Sequence:CCGGGAACCTTGCAAAGGCCTATACCTCGAGGTATAGGCCTTTGCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks