EMAIL THIS PAGE TO A FRIEND

EVX1

even-skipped homeobox 1

57 Gene Product Result for
UniProtKB ID: P49640, A4D199
Gene ID:
Human(2128) Summary: This gene encodes a member of the even-skipped homeobox family characterized by the presence of a homeodomain closely related to the Drosophila even-skipped (eve) segmentation gene of the pair-rule class. The encoded protein may play an important role as a transcriptional repressor during embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(14028) even skipped homeotic gene 1 homolog
Rat(500130) even-skipped homeobox 1
Zebrafish(30499) even-skipped homeobox 1
domestic cat(101084017) even-skipped homeobox 1
cow(540239) even-skipped homeobox 1
dog(482376) even-skipped homeobox 1
chicken(428434) even-skipped homeobox 1
sheep(101113753) even-skipped homeobox 1
Domestic Rabbit(100328791) even-skipped homeobox 1
domestic guinea pig(100717643) even-skipped homeobox 1
naked mole-rat(101706079) even-skipped homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007966 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007966 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007966 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001989 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001989 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001989 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU044451 MISSION® esiRNA esiRNA targeting mouse Evx1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001989 Rosetta Predictions human pricing
XM_001059676 Rosetta Predictions rat pricing
XM_575482 Rosetta Predictions rat pricing
NM_007966 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001989 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219986 predicted 1613
2 SASI_Hs01_00219987 predicted 1630
3 SASI_Hs01_00219988 predicted 1015
4 SASI_Hs02_00332975 predicted 1044
5 SASI_Hs01_00219989 predicted 486
6 SASI_Hs01_00219990 predicted 489
7 SASI_Hs01_00219991 predicted 1027
8 SASI_Hs01_00219992 predicted 1104
9 SASI_Hs01_00219994 predicted 1068
10 SASI_Hs01_00219995 predicted 1611
11 SASI_Hs01_00219993 predicted 1016
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00293936 predicted 694
2 SASI_Rn02_00293937 predicted 1051
3 SASI_Rn02_00293938 predicted 698
4 SASI_Rn02_00293939 predicted 829
5 SASI_Rn02_00293940 predicted 930
6 SASI_Rn02_00293941 predicted 844
7 SASI_Rn02_00293942 predicted 840
8 SASI_Rn02_00293943 predicted 997
9 SASI_Rn02_00293944 predicted 836
10 SASI_Rn02_00293945 predicted 844
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403732 predicted 694
2 SASI_Rn02_00403733 predicted 1049
3 SASI_Rn02_00403734 predicted 694
4 SASI_Rn02_00403735 predicted 827
5 SASI_Rn02_00403736 predicted 933
6 SASI_Rn02_00403737 predicted 838
7 SASI_Rn02_00403738 predicted 843
8 SASI_Rn02_00403739 predicted 988
9 SASI_Rn02_00403740 predicted 837
10 SASI_Rn02_00403741 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007966 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154493 predicted 999
2 SASI_Mm01_00154494 predicted 677
3 SASI_Mm01_00154495 predicted 685
4 SASI_Mm01_00154496 predicted 988
5 SASI_Mm01_00154497 predicted 997
6 SASI_Mm01_00154498 predicted 754
7 SASI_Mm01_00154499 predicted 999
8 SASI_Mm01_00154500 predicted 882
9 SASI_Mm01_00154501 predicted 1967
10 SASI_Mm01_00154502 predicted 897
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007966
EVX1 MISSION shRNA Bacterial Glycerol Stock
even-skipped homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-407s21c1
Sequence:CCGGTGGTAAGAGGGTCTCTAATTTCTCGAGAAATTAGAGACCCTCTTACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-967s21c1
Sequence:CCGGACGTTTCAAGACCGCGGAGATCTCGAGATCTCCGCGGTCTTGAAACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007966.4-1978s21c1
Sequence:CCGGTGCGAAGGGAACTCGCTGTTTCTCGAGAAACAGCGAGTTCCCTTCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007966.1-2219s1c1
Sequence:CCGGGCCACTGACTTCTTTCCCTATCTCGAGATAGGGAAAGAAGTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1001s1c1
Sequence:CCGGCAGCCTTAAACCTTCCTGAAACTCGAGTTTCAGGAAGGTTTAAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-694s1c1
Sequence:CCGGGAATCGGATTTCTATGAAGAACTCGAGTTCTTCATAGAAATCCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1011s1c1
Sequence:CCGGCCTTCCTGAAACTACCATCAACTCGAGTTGATGGTAGTTTCAGGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1000s1c1
Sequence:CCGGGCAGCCTTAAACCTTCCTGAACTCGAGTTCAGGAAGGTTTAAGGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007966
EVX1 MISSION shRNA shRNA Plasmid DNA
even-skipped homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-407s21c1
Sequence:CCGGTGGTAAGAGGGTCTCTAATTTCTCGAGAAATTAGAGACCCTCTTACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-967s21c1
Sequence:CCGGACGTTTCAAGACCGCGGAGATCTCGAGATCTCCGCGGTCTTGAAACGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007966.4-1978s21c1
Sequence:CCGGTGCGAAGGGAACTCGCTGTTTCTCGAGAAACAGCGAGTTCCCTTCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007966.1-2219s1c1
Sequence:CCGGGCCACTGACTTCTTTCCCTATCTCGAGATAGGGAAAGAAGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1001s1c1
Sequence:CCGGCAGCCTTAAACCTTCCTGAAACTCGAGTTTCAGGAAGGTTTAAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-694s1c1
Sequence:CCGGGAATCGGATTTCTATGAAGAACTCGAGTTCTTCATAGAAATCCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1011s1c1
Sequence:CCGGCCTTCCTGAAACTACCATCAACTCGAGTTGATGGTAGTTTCAGGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1000s1c1
Sequence:CCGGGCAGCCTTAAACCTTCCTGAACTCGAGTTCAGGAAGGTTTAAGGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007966
EVX1 MISSION shRNA Lentiviral Transduction Particles
even-skipped homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-407s21c1
Sequence:CCGGTGGTAAGAGGGTCTCTAATTTCTCGAGAAATTAGAGACCCTCTTACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007966.4-967s21c1
Sequence:CCGGACGTTTCAAGACCGCGGAGATCTCGAGATCTCCGCGGTCTTGAAACGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425469    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007966.4-1978s21c1
Sequence:CCGGTGCGAAGGGAACTCGCTGTTTCTCGAGAAACAGCGAGTTCCCTTCGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007966.1-2219s1c1
Sequence:CCGGGCCACTGACTTCTTTCCCTATCTCGAGATAGGGAAAGAAGTCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1001s1c1
Sequence:CCGGCAGCCTTAAACCTTCCTGAAACTCGAGTTTCAGGAAGGTTTAAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-694s1c1
Sequence:CCGGGAATCGGATTTCTATGAAGAACTCGAGTTCTTCATAGAAATCCGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1011s1c1
Sequence:CCGGCCTTCCTGAAACTACCATCAACTCGAGTTGATGGTAGTTTCAGGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007966.1-1000s1c1
Sequence:CCGGGCAGCCTTAAACCTTCCTGAACTCGAGTTCAGGAAGGTTTAAGGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001989
EVX1 MISSION shRNA Bacterial Glycerol Stock
even-skipped homeobox 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-1024s21c1
Sequence:CCGGAGTGACCAGATGCGTCGTTACCTCGAGGTAACGACGCATCTGGTCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-845s21c1
Sequence:CCGGATGAAGAAATCGAGGTGAGCTCTCGAGAGCTCACCTCGATTTCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-542s21c1
Sequence:CCGGTGGTTGGCAAGAGAGTCTCAACTCGAGTTGAGACTCTCTTGCCAACCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-988s1c1
Sequence:CCGGCGCCTTCTACACTTACATGATCTCGAGATCATGTAAGTGTAGAAGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-569s1c1
Sequence:CCGGGACACCGAGTCGGATTTCTATCTCGAGATAGAAATCCGACTCGGTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-296s1c1
Sequence:CCGGAGAGTCTCAAATTTGTCCGAACTCGAGTTCGGACAAATTTGAGACTCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-577s1c1
Sequence:CCGGGTCGGATTTCTATGAAGAAATCTCGAGATTTCTTCATAGAAATCCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-882s1c1
Sequence:CCGGCCGCCCTAAACCTGCCGGAAACTCGAGTTTCCGGCAGGTTTAGGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001989
EVX1 MISSION shRNA shRNA Plasmid DNA
even-skipped homeobox 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-1024s21c1
Sequence:CCGGAGTGACCAGATGCGTCGTTACCTCGAGGTAACGACGCATCTGGTCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-845s21c1
Sequence:CCGGATGAAGAAATCGAGGTGAGCTCTCGAGAGCTCACCTCGATTTCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-542s21c1
Sequence:CCGGTGGTTGGCAAGAGAGTCTCAACTCGAGTTGAGACTCTCTTGCCAACCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-988s1c1
Sequence:CCGGCGCCTTCTACACTTACATGATCTCGAGATCATGTAAGTGTAGAAGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-569s1c1
Sequence:CCGGGACACCGAGTCGGATTTCTATCTCGAGATAGAAATCCGACTCGGTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-296s1c1
Sequence:CCGGAGAGTCTCAAATTTGTCCGAACTCGAGTTCGGACAAATTTGAGACTCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-577s1c1
Sequence:CCGGGTCGGATTTCTATGAAGAAATCTCGAGATTTCTTCATAGAAATCCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-882s1c1
Sequence:CCGGCCGCCCTAAACCTGCCGGAAACTCGAGTTTCCGGCAGGTTTAGGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001989
EVX1 MISSION shRNA Lentiviral Transduction Particles
even-skipped homeobox 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-1024s21c1
Sequence:CCGGAGTGACCAGATGCGTCGTTACCTCGAGGTAACGACGCATCTGGTCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-845s21c1
Sequence:CCGGATGAAGAAATCGAGGTGAGCTCTCGAGAGCTCACCTCGATTTCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001989.3-542s21c1
Sequence:CCGGTGGTTGGCAAGAGAGTCTCAACTCGAGTTGAGACTCTCTTGCCAACCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-988s1c1
Sequence:CCGGCGCCTTCTACACTTACATGATCTCGAGATCATGTAAGTGTAGAAGGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-569s1c1
Sequence:CCGGGACACCGAGTCGGATTTCTATCTCGAGATAGAAATCCGACTCGGTGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-296s1c1
Sequence:CCGGAGAGTCTCAAATTTGTCCGAACTCGAGTTCGGACAAATTTGAGACTCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-577s1c1
Sequence:CCGGGTCGGATTTCTATGAAGAAATCTCGAGATTTCTTCATAGAAATCCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001989.2-882s1c1
Sequence:CCGGCCGCCCTAAACCTGCCGGAAACTCGAGTTTCCGGCAGGTTTAGGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)