EMAIL THIS PAGE TO A FRIEND

EVX2

even-skipped homeobox 2

62 Gene Product Result for
Synonyms: EVX-2
UniProtKB ID: Q03828
Gene ID:
Human(344191) Summary: This gene is located at the 5' end of the HOXD gene cluster on chromosome 2. The encoded protein is a homeobox transcription factor that is related to the protein encoded by the Drosophila even-skipped (eve) gene, a member of the pair-rule class of segmentation genes. A 117 kb microdeletion at the 5' end of the HOXD gene cluster, which includes this gene and the HOXD9-HOXD13 genes, causes synpolydactyly, a dominantly inherited disease resulting in limb malformation. [provided by RefSeq, Sep 2009]
Mouse(14029) even skipped homeotic gene 2 homolog
Rat(288155) even-skipped homeobox 2
Zebrafish(30479) even-skipped homeobox 2
chicken(771375) even-skipped homeobox 2
dog(609915) even-skipped homeobox 2
cow(100336775) even-skipped homeobox 2
cow(520425) even-skipped homeobox 2
domestic cat(101091644) even-skipped homeobox 2
naked mole-rat(101719780) even-skipped homeobox 2
domestic guinea pig(100723869) even-skipped homeobox 2
sheep(101104891) even-skipped homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_292968 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_292968 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_292968 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080458 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080458 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080458 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080458 Rosetta Predictions human pricing
XM_292968 Rosetta Predictions human pricing
XM_001063297 Rosetta Predictions rat pricing
XM_221512 Rosetta Predictions rat pricing
NM_007967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080458 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315036 predicted 732
2 SASI_Hs02_00315037 predicted 241
3 SASI_Hs02_00315038 predicted 480
4 SASI_Hs02_00315039 predicted 764
5 SASI_Hs02_00315040 predicted 476
6 SASI_Hs02_00315041 predicted 263
7 SASI_Hs02_00315042 predicted 386
8 SASI_Hs02_00315043 predicted 402
9 SASI_Hs02_00315044 predicted 606
10 SASI_Hs02_00315045 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_292968 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283813 predicted 241
2 SASI_Hs01_00283814 predicted 238
3 SASI_Hs01_00283815 predicted 230
4 SASI_Hs01_00283816 predicted 245
5 SASI_Hs01_00283817 predicted 270
6 SASI_Hs01_00283818 predicted 231
7 SASI_Hs01_00283819 predicted 248
8 SASI_Hs01_00283820 predicted 234
9 SASI_Hs01_00283821 predicted 286
10 SASI_Hs01_00283822 predicted 257
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00306550 predicted 502
2 SASI_Rn02_00306551 predicted 473
3 SASI_Rn02_00306552 predicted 1108
4 SASI_Rn02_00306553 predicted 1237
5 SASI_Rn02_00306554 predicted 1108
6 SASI_Rn02_00306555 predicted 971
7 SASI_Rn02_00306556 predicted 477
8 SASI_Rn02_00306557 predicted 479
9 SASI_Rn02_00306558 predicted 624
10 SASI_Rn02_00306559 predicted 1230
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221512 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380201 predicted 497
2 SASI_Rn02_00380202 predicted 1596
3 SASI_Rn02_00380203 predicted 475
4 SASI_Rn02_00380204 predicted 974
5 SASI_Rn02_00380205 predicted 1669
6 SASI_Rn02_00380206 predicted 1761
7 SASI_Rn02_00380207 predicted 484
8 SASI_Rn02_00380208 predicted 1700
9 SASI_Rn02_00380209 predicted 1190
10 SASI_Rn02_00380210 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194088 predicted 746
2 SASI_Mm01_00194089 predicted 279
3 SASI_Mm01_00194090 predicted 819
4 SASI_Mm01_00194091 predicted 838
5 SASI_Mm01_00194092 predicted 263
6 SASI_Mm01_00194093 predicted 198
7 SASI_Mm01_00194094 predicted 816
8 SASI_Mm01_00194095 predicted 212
9 SASI_Mm01_00194096 predicted 809
10 SASI_Mm01_00194097 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007967
EVX2 MISSION shRNA Bacterial Glycerol Stock
even-skipped homeobox 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-687s1c1
Sequence:CCGGCCTGCCCGAAACCACCATCAACTCGAGTTGATGGTGGTTTCGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-296s1c1
Sequence:CCGGGCAAGAAGCCTAGTCATTATTCTCGAGAATAATGACTAGGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-294s1c1
Sequence:CCGGCCGCAAGAAGCCTAGTCATTACTCGAGTAATGACTAGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-977s1c1
Sequence:CCGGGTGCGCTTTCACATCCTTATTCTCGAGAATAAGGATGTGAAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-199s1c1
Sequence:CCGGGCCAAAGGCAAATTCGAAATACTCGAGTATTTCGAATTTGCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-612s21c1
Sequence:CCGGGCGCCTGGAGAAAGAGTTCTACTCGAGTAGAACTCTTTCTCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-416s21c1
Sequence:CCGGACAATGCCAAAGGGTACACGGCTCGAGCCGTGTACCCTTTGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-256s21c1
Sequence:CCGGAGCACCGTCTCCTCCGAAATTCTCGAGAATTTCGGAGGAGACGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-72s21c1
Sequence:CCGGGTTCTCCAGTTTGTCCGATTCCTCGAGGAATCGGACAAACTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007967
EVX2 MISSION shRNA shRNA Plasmid DNA
even-skipped homeobox 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-687s1c1
Sequence:CCGGCCTGCCCGAAACCACCATCAACTCGAGTTGATGGTGGTTTCGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-296s1c1
Sequence:CCGGGCAAGAAGCCTAGTCATTATTCTCGAGAATAATGACTAGGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-294s1c1
Sequence:CCGGCCGCAAGAAGCCTAGTCATTACTCGAGTAATGACTAGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-977s1c1
Sequence:CCGGGTGCGCTTTCACATCCTTATTCTCGAGAATAAGGATGTGAAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-199s1c1
Sequence:CCGGGCCAAAGGCAAATTCGAAATACTCGAGTATTTCGAATTTGCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-612s21c1
Sequence:CCGGGCGCCTGGAGAAAGAGTTCTACTCGAGTAGAACTCTTTCTCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-416s21c1
Sequence:CCGGACAATGCCAAAGGGTACACGGCTCGAGCCGTGTACCCTTTGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-256s21c1
Sequence:CCGGAGCACCGTCTCCTCCGAAATTCTCGAGAATTTCGGAGGAGACGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-72s21c1
Sequence:CCGGGTTCTCCAGTTTGTCCGATTCCTCGAGGAATCGGACAAACTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007967
EVX2 MISSION shRNA Lentiviral Transduction Particles
even-skipped homeobox 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-687s1c1
Sequence:CCGGCCTGCCCGAAACCACCATCAACTCGAGTTGATGGTGGTTTCGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-296s1c1
Sequence:CCGGGCAAGAAGCCTAGTCATTATTCTCGAGAATAATGACTAGGCTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-294s1c1
Sequence:CCGGCCGCAAGAAGCCTAGTCATTACTCGAGTAATGACTAGGCTTCTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-977s1c1
Sequence:CCGGGTGCGCTTTCACATCCTTATTCTCGAGAATAAGGATGTGAAAGCGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007967.1-199s1c1
Sequence:CCGGGCCAAAGGCAAATTCGAAATACTCGAGTATTTCGAATTTGCCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414585    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-612s21c1
Sequence:CCGGGCGCCTGGAGAAAGAGTTCTACTCGAGTAGAACTCTTTCTCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-416s21c1
Sequence:CCGGACAATGCCAAAGGGTACACGGCTCGAGCCGTGTACCCTTTGGCATTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-256s21c1
Sequence:CCGGAGCACCGTCTCCTCCGAAATTCTCGAGAATTTCGGAGGAGACGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007967.2-72s21c1
Sequence:CCGGGTTCTCCAGTTTGTCCGATTCCTCGAGGAATCGGACAAACTGGAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_292968
EVX2 MISSION shRNA Bacterial Glycerol Stock
even-skipped homeobox 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000017878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-213s1c1
Sequence:CCGGCGAAATAGACACTTTGTTCAACTCGAGTTGAACAAAGTGTCTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-782s1c1
Sequence:CCGGCAGCGGGAGAAAGAGTTGAAACTCGAGTTTCAACTCTTTCTCCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-839s1c1
Sequence:CCGGACTGCTGTGTTGGAACTCTTACTCGAGTAAGAGTTCCAACACAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-1299s1c1
Sequence:CCGGCAGCTTCTACACCTACATGATCTCGAGATCATGTAGGTGTAGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_292968
EVX2 MISSION shRNA shRNA Plasmid DNA
even-skipped homeobox 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000017878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-213s1c1
Sequence:CCGGCGAAATAGACACTTTGTTCAACTCGAGTTGAACAAAGTGTCTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-782s1c1
Sequence:CCGGCAGCGGGAGAAAGAGTTGAAACTCGAGTTTCAACTCTTTCTCCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-839s1c1
Sequence:CCGGACTGCTGTGTTGGAACTCTTACTCGAGTAAGAGTTCCAACACAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-1299s1c1
Sequence:CCGGCAGCTTCTACACCTACATGATCTCGAGATCATGTAGGTGTAGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_292968
EVX2 MISSION shRNA Lentiviral Transduction Particles
even-skipped homeobox 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000017878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-213s1c1
Sequence:CCGGCGAAATAGACACTTTGTTCAACTCGAGTTGAACAAAGTGTCTATTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-782s1c1
Sequence:CCGGCAGCGGGAGAAAGAGTTGAAACTCGAGTTTCAACTCTTTCTCCCGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-839s1c1
Sequence:CCGGACTGCTGTGTTGGAACTCTTACTCGAGTAAGAGTTCCAACACAGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_292968.3-1299s1c1
Sequence:CCGGCAGCTTCTACACCTACATGATCTCGAGATCATGTAGGTGTAGAAGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080458
EVX2 MISSION shRNA Bacterial Glycerol Stock
even-skipped homeobox 2
Human
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000436839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-412s21c1
Sequence:CCGGTTGTTCAACCTGCAGCACACGCTCGAGCGTGTGCTGCAGGTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-605s21c1
Sequence:CCGGATGGCAAAGGGTACGCAGAGACTCGAGTCTCTGCGTACCCTTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-1109s21c1
Sequence:CCGGCTTCGTCGCCCTTCGCTACTTCTCGAGAAGTAGCGAAGGGCGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080458
EVX2 MISSION shRNA shRNA Plasmid DNA
even-skipped homeobox 2
Human
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000436839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-412s21c1
Sequence:CCGGTTGTTCAACCTGCAGCACACGCTCGAGCGTGTGCTGCAGGTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-605s21c1
Sequence:CCGGATGGCAAAGGGTACGCAGAGACTCGAGTCTCTGCGTACCCTTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-1109s21c1
Sequence:CCGGCTTCGTCGCCCTTCGCTACTTCTCGAGAAGTAGCGAAGGGCGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080458
EVX2 MISSION shRNA Lentiviral Transduction Particles
even-skipped homeobox 2
Human
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000436839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-412s21c1
Sequence:CCGGTTGTTCAACCTGCAGCACACGCTCGAGCGTGTGCTGCAGGTTGAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-605s21c1
Sequence:CCGGATGGCAAAGGGTACGCAGAGACTCGAGTCTCTGCGTACCCTTTGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436449    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080458.1-1109s21c1
Sequence:CCGGCTTCGTCGCCCTTCGCTACTTCTCGAGAAGTAGCGAAGGGCGACGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks