EMAIL THIS PAGE TO A FRIEND

EWSR1

EWS RNA-binding protein 1

167 Gene Product Result for
Synonyms: EWS bK984G1.4
Gene ID:
Human(2130) Summary: This gene encodes a multifunctional protein that is involved in various cellular processes, including gene expression, cell signaling, and RNA processing and transport. The protein includes an N-terminal transcriptional activation domain and a C-terminal RNA-binding domain. Chromosomal translocations between this gene and various genes encoding transcription factors result in the production of chimeric proteins that are involved in tumorigenesis. These chimeric proteins usually consist of the N-terminal transcriptional activation domain of this protein fused to the C-terminal DNA-binding domain of the transcription factor protein. Mutations in this gene, specifically a t(11;22)(q24;q12) translocation, are known to cause Ewing sarcoma as well as neuroectodermal and various other tumors. Alternative splicing of this gene results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 1 and 14. [provided by RefSeq, Jul 2009]
Mouse(14030) Ewing sarcoma breakpoint region 1
Rat(289752) EWS RNA-binding protein 1
sheep(101121203) Ewing sarcoma breakpoint region 1
domestic guinea pig(100718262) EWS RNA-binding protein 1
naked mole-rat(101697325) EWS RNA-binding protein 1
chicken(417022) Ewing sarcoma breakpoint region 1
dog(609786) Ewing sarcoma breakpoint region 1
domestic cat(101093398) Ewing sarcoma breakpoint region 1
cow(534073) Ewing sarcoma breakpoint region 1
Horse(100034010) Ewing sarcoma breakpoint region 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300635 Anti-EWS antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB2500370 Anti-EWS/EWSR1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, rat, bovine, human
ELISA, immunohistochemistry, western blot pricing
E4408 Anti-EWSR1 (26-40) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
E4533 Anti-EWSR1 (331-345) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2100727 Anti-EWSR1 (ab1) antibody produced in rabbit affinity isolated antibody rat, canine, human, horse, mouse, bovine, guinea pig, rabbit
western blot pricing
SAB2100728 Anti-EWSR1 (ab2) antibody produced in rabbit affinity isolated antibody rat, horse, rabbit, canine, zebrafish, human, mouse, bovine, guinea pig
western blot pricing
GW21286A Anti-EWSR1 antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1405774 Anti-EWSR1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV40750 Anti-EWSR1 antibody produced in rabbit affinity isolated antibody mouse, bovine, horse, human, rabbit, canine, guinea pig, zebrafish, rat
western blot pricing
HPA051771 Anti-EWSR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA062953 Anti-EWSR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0002130M1 Monoclonal Anti-EWSR1 antibody produced in mouse clone 5C10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403797 Monoclonal Anti-EWSR1 antibody produced in mouse clone 3A9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
PLA0104 Rabbit anti-EWS Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gibbon, primate, gorilla, chimpanzee, marmoset, rhesus monkey
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007968 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007968 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007968 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005243 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU115631 MISSION® esiRNA esiRNA human EWSR1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005243 Rosetta Predictions human pricing
NM_013986 Rosetta Predictions human pricing
NM_001025632 Rosetta Predictions rat pricing
XM_001065285 Rosetta Predictions rat pricing
XM_001065346 Rosetta Predictions rat pricing
XM_001068194 Rosetta Predictions rat pricing
XM_001068285 Rosetta Predictions rat pricing
XM_001068438 Rosetta Predictions rat pricing
XM_001068487 Rosetta Predictions rat pricing
XM_001068534 Rosetta Predictions rat pricing
NM_007968 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126564 predicted 738
2 SASI_Hs01_00126565 predicted 660
3 SASI_Hs01_00126566 predicted 879
4 SASI_Hs01_00126567 predicted 575
5 SASI_Hs01_00126570 predicted 1873
6 SASI_Hs01_00126571 predicted 1641
7 SASI_Hs02_00339250 predicted 730
8 SASI_Hs02_00339251 predicted 634
9 SASI_Hs02_00339252 predicted 1586
10 SASI_Hs02_00339253 predicted 1524
11 SASI_Hs01_00126568 predicted 480
12 SASI_Hs01_00126569 predicted 542
13 SASI_Hs01_00126572 predicted 537
14 SASI_Hs01_00126573 predicted 241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210169 predicted 734
2 SASI_Hs01_00210170 predicted 659
3 SASI_Hs01_00210171 predicted 875
4 SASI_Hs01_00210172 predicted 581
5 SASI_Hs01_00210175 predicted 1662
6 SASI_Hs01_00210176 predicted 1419
7 SASI_Hs02_00344942 predicted 731
8 SASI_Hs02_00344943 predicted 637
9 SASI_Hs02_00344944 predicted 1365
10 SASI_Hs02_00344945 predicted 1302
11 SASI_Hs01_00210173 predicted 489
12 SASI_Hs01_00210174 predicted 557
13 SASI_Hs01_00210177 predicted 551
14 SASI_Hs01_00210178 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203193 predicted 473
2 SASI_Rn02_00203194 predicted 649
3 SASI_Rn02_00203195 predicted 1104
4 SASI_Rn02_00203196 predicted 521
5 SASI_Rn02_00203197 predicted 1621
6 SASI_Rn02_00203198 predicted 1186
7 SASI_Rn02_00203199 predicted 1228
8 SASI_Rn02_00203200 predicted 635
9 SASI_Rn02_00203201 predicted 1272
10 SASI_Rn02_00203202 predicted 1080
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313555 predicted 1607
2 SASI_Rn02_00313556 predicted 1352
3 SASI_Rn02_00313557 predicted 1249
4 SASI_Rn02_00313558 predicted 1285
5 SASI_Rn02_00313559 predicted 1345
6 SASI_Rn02_00313560 predicted 1699
7 SASI_Rn02_00313561 predicted 1269
8 SASI_Rn02_00313562 predicted 1492
9 SASI_Rn02_00313563 predicted 1906
10 SASI_Rn02_00313564 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313813 predicted 4058
2 SASI_Rn02_00313814 predicted 3792
3 SASI_Rn02_00313815 predicted 3696
4 SASI_Rn02_00313816 predicted 3725
5 SASI_Rn02_00313817 predicted 3786
6 SASI_Rn02_00313818 predicted 4148
7 SASI_Rn02_00313819 predicted 3712
8 SASI_Rn02_00313820 predicted 3941
9 SASI_Rn02_00313821 predicted 4349
10 SASI_Rn02_00313822 predicted 3862
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068194 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323785 predicted 415
2 SASI_Rn02_00323786 predicted 864
3 SASI_Rn02_00323787 predicted 718
4 SASI_Rn02_00323788 predicted 942
5 SASI_Rn02_00323789 predicted 988
6 SASI_Rn02_00323790 predicted 842
7 SASI_Rn02_00323791 predicted 1032
8 SASI_Rn02_00323792 predicted 1089
9 SASI_Rn02_00323793 predicted 338
10 SASI_Rn02_00323794 predicted 1455
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068285 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324081 predicted 473
2 SASI_Rn02_00324082 predicted 658
3 SASI_Rn02_00324083 predicted 1096
4 SASI_Rn02_00324084 predicted 529
5 SASI_Rn02_00324085 predicted 1621
6 SASI_Rn02_00324086 predicted 1176
7 SASI_Rn02_00324087 predicted 1231
8 SASI_Rn02_00324088 predicted 643
9 SASI_Rn02_00324089 predicted 1078
10 SASI_Rn02_00324090 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068438 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324537 predicted 477
2 SASI_Rn02_00324538 predicted 657
3 SASI_Rn02_00324539 predicted 889
4 SASI_Rn02_00324540 predicted 528
5 SASI_Rn02_00324541 predicted 1416
6 SASI_Rn02_00324542 predicted 975
7 SASI_Rn02_00324543 predicted 1024
8 SASI_Rn02_00324544 predicted 646
9 SASI_Rn02_00324545 predicted 1065
10 SASI_Rn02_00324546 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324675 predicted 482
2 SASI_Rn02_00324676 predicted 657
3 SASI_Rn02_00324677 predicted 997
4 SASI_Rn02_00324678 predicted 530
5 SASI_Rn02_00324679 predicted 1520
6 SASI_Rn02_00324680 predicted 1082
7 SASI_Rn02_00324681 predicted 1132
8 SASI_Rn02_00324682 predicted 644
9 SASI_Rn02_00324683 predicted 1176
10 SASI_Rn02_00324684 predicted 1229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324855 predicted 473
2 SASI_Rn02_00324856 predicted 652
3 SASI_Rn02_00324857 predicted 1114
4 SASI_Rn02_00324858 predicted 532
5 SASI_Rn02_00324859 predicted 1630
6 SASI_Rn02_00324860 predicted 1196
7 SASI_Rn02_00324861 predicted 1238
8 SASI_Rn02_00324862 predicted 648
9 SASI_Rn02_00324863 predicted 1286
10 SASI_Rn02_00324864 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007968 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312851 predicted 1121
2 SASI_Mm02_00312852 predicted 487
3 SASI_Mm02_00312853 predicted 663
4 SASI_Mm02_00312854 predicted 1064
5 SASI_Mm02_00312855 predicted 1132
6 SASI_Mm02_00312856 predicted 1207
7 SASI_Mm02_00312857 predicted 541
8 SASI_Mm02_00312858 predicted 1288
9 SASI_Mm02_00312859 predicted 382
10 SASI_Mm02_00312860 predicted 656
11 SASI_Mm01_00053748 predicted 640
12 SASI_Mm01_00053749 predicted 617
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007968
EWSR1 MISSION shRNA Bacterial Glycerol Stock
EWS RNA-binding protein 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2039s21c1
Sequence:CCGGGCATTGACGACCAGATTTATTCTCGAGAATAAATCTGGTCGTCAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-268s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1232s21c1
Sequence:CCGGTGGACAACCCATGATCCATATCTCGAGATATGGATCATGGGTTGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-194s21c1
Sequence:CCGGGCCTACTGATGTCAGCTATACCTCGAGGTATAGCTGACATCAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1177s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2109s21c1
Sequence:CCGGGGCGACAACATTATGATTATTCTCGAGAATAATCATAATGTTGTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-870s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007968.1-2036s1c1
Sequence:CCGGGCTGCATTGAGTACCAGATTTCTCGAGAAATCTGGTACTCAATGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1137s1c1
Sequence:CCGGGCAATTTATGTGCAAGGATTACTCGAGTAATCCTTGCACATAAATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-192s1c1
Sequence:CCGGCAGCCTACTGATGTCAGCTATCTCGAGATAGCTGACATCAGTAGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1244s1c1
Sequence:CCGGGATCCATATCTACCTGGATAACTCGAGTTATCCAGGTAGATATGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-804s1c1
Sequence:CCGGGCTCCAAGTCAATATAGCCAACTCGAGTTGGCTATATTGACTTGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007968
EWSR1 MISSION shRNA shRNA Plasmid DNA
EWS RNA-binding protein 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2039s21c1
Sequence:CCGGGCATTGACGACCAGATTTATTCTCGAGAATAAATCTGGTCGTCAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-268s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1232s21c1
Sequence:CCGGTGGACAACCCATGATCCATATCTCGAGATATGGATCATGGGTTGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-194s21c1
Sequence:CCGGGCCTACTGATGTCAGCTATACCTCGAGGTATAGCTGACATCAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1177s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2109s21c1
Sequence:CCGGGGCGACAACATTATGATTATTCTCGAGAATAATCATAATGTTGTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000375799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-870s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007968.1-2036s1c1
Sequence:CCGGGCTGCATTGAGTACCAGATTTCTCGAGAAATCTGGTACTCAATGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1137s1c1
Sequence:CCGGGCAATTTATGTGCAAGGATTACTCGAGTAATCCTTGCACATAAATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-192s1c1
Sequence:CCGGCAGCCTACTGATGTCAGCTATCTCGAGATAGCTGACATCAGTAGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1244s1c1
Sequence:CCGGGATCCATATCTACCTGGATAACTCGAGTTATCCAGGTAGATATGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-804s1c1
Sequence:CCGGGCTCCAAGTCAATATAGCCAACTCGAGTTGGCTATATTGACTTGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007968
EWSR1 MISSION shRNA Lentiviral Transduction Particles
EWS RNA-binding protein 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2039s21c1
Sequence:CCGGGCATTGACGACCAGATTTATTCTCGAGAATAAATCTGGTCGTCAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-268s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1232s21c1
Sequence:CCGGTGGACAACCCATGATCCATATCTCGAGATATGGATCATGGGTTGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-194s21c1
Sequence:CCGGGCCTACTGATGTCAGCTATACCTCGAGGTATAGCTGACATCAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-1177s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366871    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007968.2-2109s21c1
Sequence:CCGGGGCGACAACATTATGATTATTCTCGAGAATAATCATAATGTTGTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000375799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007968.2-870s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007968.1-2036s1c1
Sequence:CCGGGCTGCATTGAGTACCAGATTTCTCGAGAAATCTGGTACTCAATGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1137s1c1
Sequence:CCGGGCAATTTATGTGCAAGGATTACTCGAGTAATCCTTGCACATAAATTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-192s1c1
Sequence:CCGGCAGCCTACTGATGTCAGCTATCTCGAGATAGCTGACATCAGTAGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-1244s1c1
Sequence:CCGGGATCCATATCTACCTGGATAACTCGAGTTATCCAGGTAGATATGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007968.1-804s1c1
Sequence:CCGGGCTCCAAGTCAATATAGCCAACTCGAGTTGGCTATATTGACTTGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005243
VALIDATED
EWSR1 MISSION shRNA Bacterial Glycerol Stock
EWS RNA-binding protein 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1142s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1109s21c1
Sequence:CCGGTACGGGCAGCAGAGTTCATTCCTCGAGGAATGAACTCTGCTGCCCGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1293s21c1
Sequence:CCGGAGAGCGAGGTGGCTTCAATAACTCGAGTTATTGAAGCCACCTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1433s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-498s21c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-521s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-2301s21c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005243.2-2447s21c1
Sequence:CCGGTAAATGGTAGTGTGCGGAGTTCTCGAGAACTCCGCACACTACCATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-2035s1c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-155s1c1
Sequence:CCGGCAACAAAGCTATGGAACCTATCTCGAGATAGGTTCCATAGCTTTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-795s1c1
Sequence:CCGGCAAGTCAATATAGCCAACAGACTCGAGTCTGTTGGCTATATTGACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-154s1c1
Sequence:CCGGGCAACAAAGCTATGGAACCTACTCGAGTAGGTTCCATAGCTTTGTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-232s1c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005243
VALIDATED
EWSR1 MISSION shRNA shRNA Plasmid DNA
EWS RNA-binding protein 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1142s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1109s21c1
Sequence:CCGGTACGGGCAGCAGAGTTCATTCCTCGAGGAATGAACTCTGCTGCCCGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1293s21c1
Sequence:CCGGAGAGCGAGGTGGCTTCAATAACTCGAGTTATTGAAGCCACCTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1433s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-498s21c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-521s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-2301s21c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005243.2-2447s21c1
Sequence:CCGGTAAATGGTAGTGTGCGGAGTTCTCGAGAACTCCGCACACTACCATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-2035s1c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-155s1c1
Sequence:CCGGCAACAAAGCTATGGAACCTATCTCGAGATAGGTTCCATAGCTTTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-795s1c1
Sequence:CCGGCAAGTCAATATAGCCAACAGACTCGAGTCTGTTGGCTATATTGACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-154s1c1
Sequence:CCGGGCAACAAAGCTATGGAACCTACTCGAGTAGGTTCCATAGCTTTGTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-232s1c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005243
VALIDATED
EWSR1 MISSION shRNA Lentiviral Transduction Particles
EWS RNA-binding protein 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1142s21c1
Sequence:CCGGCCCAGTAGCATGGGTGTTTATCTCGAGATAAACACCCATGCTACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.3-1109s21c1
Sequence:CCGGTACGGGCAGCAGAGTTCATTCCTCGAGGAATGAACTCTGCTGCCCGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1293s21c1
Sequence:CCGGAGAGCGAGGTGGCTTCAATAACTCGAGTTATTGAAGCCACCTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-1433s21c1
Sequence:CCGGATGATCTGGCAGACTTCTTTACTCGAGTAAAGAAGTCTGCCAGATCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-498s21c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-521s21c1
Sequence:CCGGGACAGCCTCCCACTGGTTATACTCGAGTATAACCAGTGGGAGGCTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272805    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005243.2-2301s21c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320852    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005243.2-2447s21c1
Sequence:CCGGTAAATGGTAGTGTGCGGAGTTCTCGAGAACTCCGCACACTACCATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000034    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-2035s1c1
Sequence:CCGGTGCATTGACTACCAGATTTATCTCGAGATAAATCTGGTAGTCAATGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-155s1c1
Sequence:CCGGCAACAAAGCTATGGAACCTATCTCGAGATAGGTTCCATAGCTTTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-795s1c1
Sequence:CCGGCAAGTCAATATAGCCAACAGACTCGAGTCTGTTGGCTATATTGACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005243.x-154s1c1
Sequence:CCGGGCAACAAAGCTATGGAACCTACTCGAGTAGGTTCCATAGCTTTGTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000036    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005243.x-232s1c1
Sequence:CCGGGACCGCCTATGCAACTTCTTACTCGAGTAAGAAGTTGCATAGGCGGTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)