EMAIL THIS PAGE TO A FRIEND

EXD1

exonuclease 3'-5' domain containing 1

63 Gene Product Result for
Synonyms: EXDL1
UniProtKB ID: Q8NHP7, A8K909, Q6ZW94
Gene ID:
Mouse(241624) exonuclease 3'-5' domain containing 1
Rat(311334) exonuclease 3'-5' domain containing 1
chicken(771299) exonuclease 3'-5' domain containing 1
dog(478263) exonuclease 3'-5' domain containing 1
cow(617602) exonuclease 3'-5' domain containing 1
Horse(100056998) exonuclease 3'-5' domain containing 1
domestic cat(101084883) exonuclease 3'-5' domain containing 1
sheep(101115129) exonuclease 3'-5' domain containing 1
naked mole-rat(101723421) exonuclease 3'-5' domain containing 1
domestic guinea pig(100719067) exonuclease 3'-5' domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152596 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152596 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152596 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152596 Rosetta Predictions human pricing
NM_001107761 Rosetta Predictions rat pricing
NM_172857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152596 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131407 predicted 440
2 SASI_Hs01_00131408 predicted 558
3 SASI_Hs01_00131409 predicted 414
4 SASI_Hs01_00131410 predicted 677
5 SASI_Hs01_00131412 predicted 624
6 SASI_Hs01_00131414 predicted 654
7 SASI_Hs02_00366439 predicted 1389
8 SASI_Hs02_00366440 predicted 1693
9 SASI_Hs01_00131415 predicted 1739
10 SASI_Hs01_00131416 predicted 779
11 SASI_Hs01_00131411 predicted 1403
12 SASI_Hs01_00131413 predicted 1329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107761 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232005 predicted 2079
2 SASI_Rn02_00232006 predicted 1325
3 SASI_Rn02_00232007 predicted 2102
4 SASI_Rn02_00232008 predicted 1289
5 SASI_Rn02_00232009 predicted 2456
6 SASI_Rn02_00232010 predicted 1556
7 SASI_Rn02_00232011 predicted 1568
8 SASI_Rn02_00232012 predicted 1486
9 SASI_Rn02_00232013 predicted 1423
10 SASI_Rn02_00232014 predicted 1191
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128259 predicted 1202
2 SASI_Mm01_00128260 predicted 1460
3 SASI_Mm01_00128261 predicted 1525
4 SASI_Mm01_00128262 predicted 1014
5 SASI_Mm01_00128263 predicted 2291
6 SASI_Mm01_00128264 predicted 2140
7 SASI_Mm01_00128265 predicted 1452
8 SASI_Mm02_00344806 predicted 2190
9 SASI_Mm01_00128267 predicted 878
10 SASI_Mm02_00344807 predicted 1306
11 SASI_Mm01_00128258 predicted 1304
12 SASI_Mm01_00128266 predicted 2080
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172857
EXD1 MISSION shRNA Bacterial Glycerol Stock
exonuclease 3'-5' domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-1044s1c1
Sequence:CCGGGCTGGAATGGAGAAAGTGAAACTCGAGTTTCACTTTCTCCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-2141s1c1
Sequence:CCGGCGAAGCCCATAAGGACTCTAACTCGAGTTAGAGTCCTTATGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1734s1c1
Sequence:CCGGGATGAGGTGATGTCAGACTTACTCGAGTAAGTCTGACATCACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1020s1c1
Sequence:CCGGGCTGTTAGCATAAATACAGAACTCGAGTTCTGTATTTATGCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1019s1c1
Sequence:CCGGCGCTGTTAGCATAAATACAGACTCGAGTCTGTATTTATGCTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172857.1-2919s1c1
Sequence:CCGGCCTACAGGTTAGAAATGTATTCTCGAGAATACATTTCTAACCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-960s1c1
Sequence:CCGGGATCTTGAATGTGGAACTAATCTCGAGATTAGTTCCACATTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-1531s1c1
Sequence:CCGGCCAAACTGTATCAGTACTTTGCTCGAGCAAAGTACTGATACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172857
EXD1 MISSION shRNA shRNA Plasmid DNA
exonuclease 3'-5' domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-1044s1c1
Sequence:CCGGGCTGGAATGGAGAAAGTGAAACTCGAGTTTCACTTTCTCCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-2141s1c1
Sequence:CCGGCGAAGCCCATAAGGACTCTAACTCGAGTTAGAGTCCTTATGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1734s1c1
Sequence:CCGGGATGAGGTGATGTCAGACTTACTCGAGTAAGTCTGACATCACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1020s1c1
Sequence:CCGGGCTGTTAGCATAAATACAGAACTCGAGTTCTGTATTTATGCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1019s1c1
Sequence:CCGGCGCTGTTAGCATAAATACAGACTCGAGTCTGTATTTATGCTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172857.1-2919s1c1
Sequence:CCGGCCTACAGGTTAGAAATGTATTCTCGAGAATACATTTCTAACCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-960s1c1
Sequence:CCGGGATCTTGAATGTGGAACTAATCTCGAGATTAGTTCCACATTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-1531s1c1
Sequence:CCGGCCAAACTGTATCAGTACTTTGCTCGAGCAAAGTACTGATACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172857
EXD1 MISSION shRNA Lentiviral Transduction Particles
exonuclease 3'-5' domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-1044s1c1
Sequence:CCGGGCTGGAATGGAGAAAGTGAAACTCGAGTTTCACTTTCTCCATTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182153    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.1-2141s1c1
Sequence:CCGGCGAAGCCCATAAGGACTCTAACTCGAGTTAGAGTCCTTATGGGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178303    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1734s1c1
Sequence:CCGGGATGAGGTGATGTCAGACTTACTCGAGTAAGTCTGACATCACCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1020s1c1
Sequence:CCGGGCTGTTAGCATAAATACAGAACTCGAGTTCTGTATTTATGCTAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172857.1-1019s1c1
Sequence:CCGGCGCTGTTAGCATAAATACAGACTCGAGTCTGTATTTATGCTAACAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172857.1-2919s1c1
Sequence:CCGGCCTACAGGTTAGAAATGTATTCTCGAGAATACATTTCTAACCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215521    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-960s1c1
Sequence:CCGGGATCTTGAATGTGGAACTAATCTCGAGATTAGTTCCACATTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215896    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172857.2-1531s1c1
Sequence:CCGGCCAAACTGTATCAGTACTTTGCTCGAGCAAAGTACTGATACAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152596
EXD1 MISSION shRNA Bacterial Glycerol Stock
exonuclease 3'-5' domain containing 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152596.2-1473s1c1
Sequence:CCGGGAACACTTTATGACACCCAAACTCGAGTTTGGGTGTCATAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-455s21c1
Sequence:CCGGTGGTGCTGCGATACTCCATATCTCGAGATATGGAGTATCGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152596.2-1817s21c1
Sequence:CCGGCATGTTGTAAATGTAGTAATGCTCGAGCATTACTACATTTACAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-309s21c1
Sequence:CCGGATGAAAGTTGAAGACCTAAATCTCGAGATTTAGGTCTTCAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-1010s21c1
Sequence:CCGGCCTGGTGGATGGTTACCTAAACTCGAGTTTAGGTAACCATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-554s21c1
Sequence:CCGGGGCCACAAATTGCCGAGTTTACTCGAGTAAACTCGGCAATTTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152596
EXD1 MISSION shRNA shRNA Plasmid DNA
exonuclease 3'-5' domain containing 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152596.2-1473s1c1
Sequence:CCGGGAACACTTTATGACACCCAAACTCGAGTTTGGGTGTCATAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-455s21c1
Sequence:CCGGTGGTGCTGCGATACTCCATATCTCGAGATATGGAGTATCGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152596.2-1817s21c1
Sequence:CCGGCATGTTGTAAATGTAGTAATGCTCGAGCATTACTACATTTACAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-309s21c1
Sequence:CCGGATGAAAGTTGAAGACCTAAATCTCGAGATTTAGGTCTTCAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-1010s21c1
Sequence:CCGGCCTGGTGGATGGTTACCTAAACTCGAGTTTAGGTAACCATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-554s21c1
Sequence:CCGGGGCCACAAATTGCCGAGTTTACTCGAGTAAACTCGGCAATTTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152596
EXD1 MISSION shRNA Lentiviral Transduction Particles
exonuclease 3'-5' domain containing 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152596.2-1473s1c1
Sequence:CCGGGAACACTTTATGACACCCAAACTCGAGTTTGGGTGTCATAAAGTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322776    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-455s21c1
Sequence:CCGGTGGTGCTGCGATACTCCATATCTCGAGATATGGAGTATCGCAGCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322777    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152596.2-1817s21c1
Sequence:CCGGCATGTTGTAAATGTAGTAATGCTCGAGCATTACTACATTTACAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-309s21c1
Sequence:CCGGATGAAAGTTGAAGACCTAAATCTCGAGATTTAGGTCTTCAACTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-1010s21c1
Sequence:CCGGCCTGGTGGATGGTTACCTAAACTCGAGTTTAGGTAACCATCCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152596.2-554s21c1
Sequence:CCGGGGCCACAAATTGCCGAGTTTACTCGAGTAAACTCGGCAATTTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks