EMAIL THIS PAGE TO A FRIEND

EXD2

exonuclease 3'-5' domain containing 2

81 Gene Product Result for
Synonyms: C14orf114 EXDL2
UniProtKB ID: Q9NVH0, B4DIH6, G5E947, Q6AWB6, Q8N3D3
Gene ID:
Mouse(97827) exonuclease 3'-5' domain containing 2
Rat(362759) exonuclease 3'-5' domain containing 2
domestic guinea pig(100721998) exonuclease 3'-5' domain containing 2
naked mole-rat(101710627) exonuclease 3'-5' domain containing 2
sheep(101117589) exonuclease 3'-5' domain containing 2
Zebrafish(334455) exonuclease 3'-5' domain containing 2
chicken(423264) exonuclease 3'-5' domain containing 2
dog(490750) exonuclease 3'-5' domain containing 2
Horse(100053111) exonuclease 3'-5' domain containing 2
cow(539532) exonuclease 3'-5' domain containing 2
domestic cat(101098798) exonuclease 3'-5' domain containing 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018199 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018199 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018199 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133798 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133798 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133798 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018199 Rosetta Predictions human pricing
NM_001108715 Rosetta Predictions rat pricing
NM_133798 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018199 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229105 predicted 1107
2 SASI_Hs01_00229106 predicted 652
3 SASI_Hs01_00229107 predicted 995
4 SASI_Hs01_00229108 predicted 929
5 SASI_Hs01_00229109 predicted 602
6 SASI_Hs01_00229110 predicted 446
7 SASI_Hs01_00229111 predicted 921
8 SASI_Hs01_00229112 predicted 588
9 SASI_Hs01_00229113 predicted 767
10 SASI_Hs01_00229114 predicted 239
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241365 predicted 1861
2 SASI_Rn02_00241366 predicted 2068
3 SASI_Rn02_00241367 predicted 2171
4 SASI_Rn02_00241368 predicted 637
5 SASI_Rn02_00241369 predicted 1264
6 SASI_Rn02_00241370 predicted 679
7 SASI_Rn02_00241371 predicted 823
8 SASI_Rn02_00241372 predicted 1868
9 SASI_Rn02_00241373 predicted 1071
10 SASI_Rn02_00241374 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133798 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111490 predicted 1856
2 SASI_Mm01_00111491 predicted 1537
3 SASI_Mm01_00111492 predicted 809
4 SASI_Mm02_00338826 predicted 1800
5 SASI_Mm01_00111494 predicted 1061
6 SASI_Mm01_00111495 predicted 1856
7 SASI_Mm01_00111496 predicted 1151
8 SASI_Mm01_00111497 predicted 909
9 SASI_Mm01_00111498 predicted 950
10 SASI_Mm02_00338827 predicted 946
11 SASI_Mm01_00111493 predicted 1110
12 SASI_Mm01_00111499 predicted 437
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018199
VALIDATED
EXD2 MISSION shRNA Bacterial Glycerol Stock
exonuclease 3'-5' domain containing 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-155s21c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-938s21c1
Sequence:CCGGGACTATTACTTGATGGTTAAACTCGAGTTTAACCATCAAGTAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018199.2-1935s21c1
Sequence:CCGGTTGTCTAGTGCCTCGGTTTATCTCGAGATAAACCGAGGCACTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018199.2-1001s21c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-228s21c1
Sequence:CCGGGCAAGCTTCTGCAGGATTATGCTCGAGCATAATCCTGCAGAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-652s1c1
Sequence:CCGGGCCAAGAAATAAGAAGTCTAACTCGAGTTAGACTTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-1001s1c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-155s1c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-451s1c1
Sequence:CCGGCCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-767s1c1
Sequence:CCGGCCTCTTTATGATAACTGCTTTCTCGAGAAAGCAGTTATCATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018199
VALIDATED
EXD2 MISSION shRNA shRNA Plasmid DNA
exonuclease 3'-5' domain containing 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-155s21c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-938s21c1
Sequence:CCGGGACTATTACTTGATGGTTAAACTCGAGTTTAACCATCAAGTAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018199.2-1935s21c1
Sequence:CCGGTTGTCTAGTGCCTCGGTTTATCTCGAGATAAACCGAGGCACTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018199.2-1001s21c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-228s21c1
Sequence:CCGGGCAAGCTTCTGCAGGATTATGCTCGAGCATAATCCTGCAGAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-652s1c1
Sequence:CCGGGCCAAGAAATAAGAAGTCTAACTCGAGTTAGACTTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-1001s1c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-155s1c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-451s1c1
Sequence:CCGGCCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-767s1c1
Sequence:CCGGCCTCTTTATGATAACTGCTTTCTCGAGAAAGCAGTTATCATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018199
VALIDATED
EXD2 MISSION shRNA Lentiviral Transduction Particles
exonuclease 3'-5' domain containing 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-155s21c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-938s21c1
Sequence:CCGGGACTATTACTTGATGGTTAAACTCGAGTTTAACCATCAAGTAATAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018199.2-1935s21c1
Sequence:CCGGTTGTCTAGTGCCTCGGTTTATCTCGAGATAAACCGAGGCACTAGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_018199.2-1001s21c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018199.2-228s21c1
Sequence:CCGGGCAAGCTTCTGCAGGATTATGCTCGAGCATAATCCTGCAGAAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-652s1c1
Sequence:CCGGGCCAAGAAATAAGAAGTCTAACTCGAGTTAGACTTCTTATTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-1001s1c1
Sequence:CCGGCGGAAGAACGTGATTCCACATCTCGAGATGTGGAATCACGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-155s1c1
Sequence:CCGGCCAAGAACGTTATTGGATATTCTCGAGAATATCCAATAACGTTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-451s1c1
Sequence:CCGGCCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018199.1-767s1c1
Sequence:CCGGCCTCTTTATGATAACTGCTTTCTCGAGAAAGCAGTTATCATAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133798
VALIDATED
EXD2 MISSION shRNA Bacterial Glycerol Stock
exonuclease 3'-5' domain containing 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-618s21c1
Sequence:CCGGCGCTTGCCCAGGCTGATATATCTCGAGATATATCAGCCTGGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-727s21c1
Sequence:CCGGACAAGCTTCTACAGGATTATGCTCGAGCATAATCCTGTAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-676s21c1
Sequence:CCGGTGGCAGATGGTGCTATCTTAACTCGAGTTAAGATAGCACCATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-2499s21c1
Sequence:CCGGCCCAGTTCAGCCTCACTATTTCTCGAGAAATAGTGAGGCTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-1104s21c1
Sequence:CCGGCGGCTGGTTGAAGAGGTTAATCTCGAGATTAACCTCTTCAACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-814s1c1
Sequence:CCGGGTAATGGGCTTAGCCTGAAATCTCGAGATTTCAGGCTAAGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-677s1c1
Sequence:CCGGGGCAGATGGTGCTATCTTAAACTCGAGTTTAAGATAGCACCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133798.1-2215s1c1
Sequence:CCGGCCAACTGTATTACTTGGATTTCTCGAGAAATCCAAGTAATACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-603s1c1
Sequence:CCGGGCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-1083s1c1
Sequence:CCGGCCCAGGAGATTATTACTTGATCTCGAGATCAAGTAATAATCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133798
VALIDATED
EXD2 MISSION shRNA shRNA Plasmid DNA
exonuclease 3'-5' domain containing 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-618s21c1
Sequence:CCGGCGCTTGCCCAGGCTGATATATCTCGAGATATATCAGCCTGGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-727s21c1
Sequence:CCGGACAAGCTTCTACAGGATTATGCTCGAGCATAATCCTGTAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-676s21c1
Sequence:CCGGTGGCAGATGGTGCTATCTTAACTCGAGTTAAGATAGCACCATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-2499s21c1
Sequence:CCGGCCCAGTTCAGCCTCACTATTTCTCGAGAAATAGTGAGGCTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-1104s21c1
Sequence:CCGGCGGCTGGTTGAAGAGGTTAATCTCGAGATTAACCTCTTCAACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-814s1c1
Sequence:CCGGGTAATGGGCTTAGCCTGAAATCTCGAGATTTCAGGCTAAGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-677s1c1
Sequence:CCGGGGCAGATGGTGCTATCTTAAACTCGAGTTTAAGATAGCACCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133798.1-2215s1c1
Sequence:CCGGCCAACTGTATTACTTGGATTTCTCGAGAAATCCAAGTAATACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-603s1c1
Sequence:CCGGGCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-1083s1c1
Sequence:CCGGCCCAGGAGATTATTACTTGATCTCGAGATCAAGTAATAATCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133798
VALIDATED
EXD2 MISSION shRNA Lentiviral Transduction Particles
exonuclease 3'-5' domain containing 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-618s21c1
Sequence:CCGGCGCTTGCCCAGGCTGATATATCTCGAGATATATCAGCCTGGGCAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-727s21c1
Sequence:CCGGACAAGCTTCTACAGGATTATGCTCGAGCATAATCCTGTAGAAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241904    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-676s21c1
Sequence:CCGGTGGCAGATGGTGCTATCTTAACTCGAGTTAAGATAGCACCATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241903    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-2499s21c1
Sequence:CCGGCCCAGTTCAGCCTCACTATTTCTCGAGAAATAGTGAGGCTGAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_133798.2-1104s21c1
Sequence:CCGGCGGCTGGTTGAAGAGGTTAATCTCGAGATTAACCTCTTCAACCAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-814s1c1
Sequence:CCGGGTAATGGGCTTAGCCTGAAATCTCGAGATTTCAGGCTAAGCCCATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.2-677s1c1
Sequence:CCGGGGCAGATGGTGCTATCTTAAACTCGAGTTTAAGATAGCACCATCTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191421    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_133798.1-2215s1c1
Sequence:CCGGCCAACTGTATTACTTGGATTTCTCGAGAAATCCAAGTAATACAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190454    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-603s1c1
Sequence:CCGGGCAGATTTCAGTGGCTCTCTTCTCGAGAAGAGAGCCACTGAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_133798.1-1083s1c1
Sequence:CCGGCCCAGGAGATTATTACTTGATCTCGAGATCAAGTAATAATCTCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks