EMAIL THIS PAGE TO A FRIEND

EXD3

exonuclease 3'-5' domain containing 3

19 Gene Product Result for
Synonyms: mut-7
Gene ID:
Zebrafish(100538036) exonuclease 3'-5' domain containing 3
chicken(417283) exonuclease 3'-5' domain containing 3
cow(618437) exonuclease 3'-5' domain containing 3
domestic cat(101084835) exonuclease 3'-5' domain containing 3
Horse(100059444) exonuclease 3'-5' domain containing 3
dog(100682622) exonuclease 3'-5' domain containing 3
sheep(101104737) exonuclease 3'-5' domain containing 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017820 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017820 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017820 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017820 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017820 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236756 predicted 1368
2 SASI_Hs01_00236757 predicted 2395
3 SASI_Hs01_00236758 predicted 2341
4 SASI_Hs01_00236759 predicted 365
5 SASI_Hs01_00236760 predicted 2124
6 SASI_Hs01_00236762 predicted 674
7 SASI_Hs01_00236761 predicted 1198
8 SASI_Hs01_00236763 predicted 1008
9 SASI_Hs01_00236764 predicted 1389
10 SASI_Hs01_00236765 predicted 1626
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017820
VALIDATED
EXD3 MISSION shRNA Bacterial Glycerol Stock
exonuclease 3'-5' domain containing 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-780s1c1
Sequence:CCGGCCTGGAGAAGCTGAGTCCGAACTCGAGTTCGGACTCAGCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1164s1c1
Sequence:CCGGGAAGGACATGAAGGACCGTTACTCGAGTAACGGTCCTTCATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1986s1c1
Sequence:CCGGCCGTGTGGTGTGTGACAACATCTCGAGATGTTGTCACACACCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-2215s1c1
Sequence:CCGGGCCAAGGCTGTGCTCAAGCATCTCGAGATGCTTGAGCACAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1534s1c1
Sequence:CCGGGCCCATGTGGAGAAGCAGATTCTCGAGAATCTGCTTCTCCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-1635s21c1
Sequence:CCGGCCCATGTGGAGAAGCAGATTCCTCGAGGAATCTGCTTCTCCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-2386s21c1
Sequence:CCGGTAACTGTGACCAGTACCTAAACTCGAGTTTAGGTACTGGTCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-2317s21c1
Sequence:CCGGCAAGGCTGTGCTCAAGCATTTCTCGAGAAATGCTTGAGCACAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1267s21c1
Sequence:CCGGGGACATGAAGGACCGTTACTACTCGAGTAGTAACGGTCCTTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1395s21c1
Sequence:CCGGTGGAGTGGACACCTGTGTTTGCTCGAGCAAACACAGGTGTCCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017820
VALIDATED
EXD3 MISSION shRNA shRNA Plasmid DNA
exonuclease 3'-5' domain containing 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-780s1c1
Sequence:CCGGCCTGGAGAAGCTGAGTCCGAACTCGAGTTCGGACTCAGCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1164s1c1
Sequence:CCGGGAAGGACATGAAGGACCGTTACTCGAGTAACGGTCCTTCATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1986s1c1
Sequence:CCGGCCGTGTGGTGTGTGACAACATCTCGAGATGTTGTCACACACCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-2215s1c1
Sequence:CCGGGCCAAGGCTGTGCTCAAGCATCTCGAGATGCTTGAGCACAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1534s1c1
Sequence:CCGGGCCCATGTGGAGAAGCAGATTCTCGAGAATCTGCTTCTCCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-1635s21c1
Sequence:CCGGCCCATGTGGAGAAGCAGATTCCTCGAGGAATCTGCTTCTCCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-2386s21c1
Sequence:CCGGTAACTGTGACCAGTACCTAAACTCGAGTTTAGGTACTGGTCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-2317s21c1
Sequence:CCGGCAAGGCTGTGCTCAAGCATTTCTCGAGAAATGCTTGAGCACAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1267s21c1
Sequence:CCGGGGACATGAAGGACCGTTACTACTCGAGTAGTAACGGTCCTTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1395s21c1
Sequence:CCGGTGGAGTGGACACCTGTGTTTGCTCGAGCAAACACAGGTGTCCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017820
VALIDATED
EXD3 MISSION shRNA Lentiviral Transduction Particles
exonuclease 3'-5' domain containing 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-780s1c1
Sequence:CCGGCCTGGAGAAGCTGAGTCCGAACTCGAGTTCGGACTCAGCTTCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1164s1c1
Sequence:CCGGGAAGGACATGAAGGACCGTTACTCGAGTAACGGTCCTTCATGTCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1986s1c1
Sequence:CCGGCCGTGTGGTGTGTGACAACATCTCGAGATGTTGTCACACACCACACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-2215s1c1
Sequence:CCGGGCCAAGGCTGTGCTCAAGCATCTCGAGATGCTTGAGCACAGCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017820.2-1534s1c1
Sequence:CCGGGCCCATGTGGAGAAGCAGATTCTCGAGAATCTGCTTCTCCACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-1635s21c1
Sequence:CCGGCCCATGTGGAGAAGCAGATTCCTCGAGGAATCTGCTTCTCCACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-2386s21c1
Sequence:CCGGTAACTGTGACCAGTACCTAAACTCGAGTTTAGGTACTGGTCACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017820.3-2317s21c1
Sequence:CCGGCAAGGCTGTGCTCAAGCATTTCTCGAGAAATGCTTGAGCACAGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1267s21c1
Sequence:CCGGGGACATGAAGGACCGTTACTACTCGAGTAGTAACGGTCCTTCATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236311    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_017820.3-1395s21c1
Sequence:CCGGTGGAGTGGACACCTGTGTTTGCTCGAGCAAACACAGGTGTCCACTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks