EMAIL THIS PAGE TO A FRIEND

EXO1

exonuclease 1

117 Gene Product Result for
Synonyms: HEX1 hExoI
Gene ID:
Human(9156) Summary: This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
Mouse(26909) exonuclease 1
Rat(305000) exonuclease 1
Zebrafish(406778) exonuclease 1
dog(490370) exonuclease 1
domestic cat(101093573) exonuclease 1
cow(506390) exonuclease 1
Horse(100054824) exonuclease 1
chicken(421505) exonuclease 1
sheep(101120258) exonuclease 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130398 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_130398 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_130398 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_012012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003686 Rosetta Predictions human pricing
NM_006027 Rosetta Predictions human pricing
NM_130398 Rosetta Predictions human pricing
NM_001107198 Rosetta Predictions rat pricing
NM_012012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076269 predicted 643
2 SASI_Hs01_00076270 predicted 2128
3 SASI_Hs01_00076272 predicted 2370
4 SASI_Hs01_00076274 predicted 2529
5 SASI_Hs02_00336097 predicted 1780
6 SASI_Hs02_00336098 predicted 1665
7 SASI_Hs01_00076275 predicted 1637
8 SASI_Hs01_00076276 predicted 2036
9 SASI_Hs01_00076277 predicted 653
10 SASI_Hs01_00076278 predicted 2555
11 SASI_Hs01_00076271 predicted 2011
12 SASI_Hs01_00076273 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078980 predicted 638
2 SASI_Hs01_00078981 predicted 2132
3 SASI_Hs01_00078983 predicted 2372
4 SASI_Hs01_00078985 predicted 2533
5 SASI_Hs02_00340758 predicted 1778
6 SASI_Hs02_00340759 predicted 1661
7 SASI_Hs01_00078986 predicted 1634
8 SASI_Hs01_00078987 predicted 2044
9 SASI_Hs01_00078988 predicted 650
10 SASI_Hs01_00078989 predicted 2562
11 SASI_Hs01_00078982 predicted 2005
12 SASI_Hs01_00078984 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130398 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067864 predicted 746
2 SASI_Hs01_00067865 predicted 2232
3 SASI_Hs01_00067867 predicted 2477
4 SASI_Hs01_00067869 predicted 2635
5 SASI_Hs02_00362726 predicted 1883
6 SASI_Hs02_00362727 predicted 1768
7 SASI_Hs01_00067870 predicted 1740
8 SASI_Hs01_00067871 predicted 2148
9 SASI_Hs01_00067872 predicted 760
10 SASI_Hs01_00067873 predicted 2669
11 SASI_Hs01_00067866 predicted 2112
12 SASI_Hs01_00067868 predicted 794
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107198 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226475 predicted 880
2 SASI_Rn02_00226476 predicted 1820
3 SASI_Rn02_00226477 predicted 1343
4 SASI_Rn02_00226478 predicted 2234
5 SASI_Rn02_00226479 predicted 966
6 SASI_Rn02_00226480 predicted 1327
7 SASI_Rn02_00226481 predicted 1832
8 SASI_Rn02_00226482 predicted 1079
9 SASI_Rn02_00226483 predicted 1852
10 SASI_Rn02_00226484 predicted 2225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174981 predicted 1045
2 SASI_Mm01_00174982 predicted 312
3 SASI_Mm01_00174983 predicted 1286
4 SASI_Mm01_00174984 predicted 1358
5 SASI_Mm01_00174985 predicted 1828
6 SASI_Mm01_00174986 predicted 2707
7 SASI_Mm01_00174987 predicted 1499
8 SASI_Mm02_00321954 predicted 1448
9 SASI_Mm02_00321955 predicted 2253
10 SASI_Mm01_00174990 predicted 1442
11 SASI_Mm01_00174988 predicted 2320
12 SASI_Mm01_00174989 predicted 2240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130398
VALIDATED
EXO1 MISSION shRNA Bacterial Glycerol Stock
exonuclease 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130398.2-3083s21c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-3053s21c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-2745s21c1
Sequence:CCGGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-1372s21c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3083s1c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-2699s1c1
Sequence:CCGGCCAAGCTATGTTTATCTCATTCTCGAGAATGAGATAAACATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1926s1c1
Sequence:CCGGCCTGGTAAATGGACCTACTAACTCGAGTTAGTAGGTCCATTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1372s1c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3053s1c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-2736s1c1
Sequence:CCGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-3072s1c1
Sequence:CCGGAATGCAGACTGCTGCAAAGCTCTCGAGAGCTTTGCAGCAGTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130398.x-1586s1c1
Sequence:CCGGAAGTCATAGTTGGGATGACACTCGAGTGTCATCCCAACTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130398
VALIDATED
EXO1 MISSION shRNA shRNA Plasmid DNA
exonuclease 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130398.2-3083s21c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-3053s21c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-2745s21c1
Sequence:CCGGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-1372s21c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3083s1c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-2699s1c1
Sequence:CCGGCCAAGCTATGTTTATCTCATTCTCGAGAATGAGATAAACATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1926s1c1
Sequence:CCGGCCTGGTAAATGGACCTACTAACTCGAGTTAGTAGGTCCATTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1372s1c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3053s1c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-2736s1c1
Sequence:CCGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-3072s1c1
Sequence:CCGGAATGCAGACTGCTGCAAAGCTCTCGAGAGCTTTGCAGCAGTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130398.x-1586s1c1
Sequence:CCGGAAGTCATAGTTGGGATGACACTCGAGTGTCATCCCAACTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130398
VALIDATED
EXO1 MISSION shRNA Lentiviral Transduction Particles
exonuclease 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331178    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130398.2-3083s21c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-3053s21c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-2745s21c1
Sequence:CCGGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130398.2-1372s21c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039788    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3083s1c1
Sequence:CCGGTGCAGACTGCTGCAAAGCTTTCTCGAGAAAGCTTTGCAGCAGTCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-2699s1c1
Sequence:CCGGCCAAGCTATGTTTATCTCATTCTCGAGAATGAGATAAACATAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1926s1c1
Sequence:CCGGCCTGGTAAATGGACCTACTAACTCGAGTTAGTAGGTCCATTTACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-1372s1c1
Sequence:CCGGGCCAACAATACCTTCCTCTATCTCGAGATAGAGGAAGGTATTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.2-3053s1c1
Sequence:CCGGGCCGTGTTCAAAGAGCAATATCTCGAGATATTGCTCTTTGAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-2736s1c1
Sequence:CCGGAACAAGGTTCCTGGGCTATACTCGAGTATAGCCCAGGAACCTTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_130398.x-3072s1c1
Sequence:CCGGAATGCAGACTGCTGCAAAGCTCTCGAGAGCTTTGCAGCAGTCTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009833    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130398.x-1586s1c1
Sequence:CCGGAAGTCATAGTTGGGATGACACTCGAGTGTCATCCCAACTATGACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012012
VALIDATED
EXO1 MISSION shRNA Bacterial Glycerol Stock
exonuclease 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-372s21c1
Sequence:GTACCGGGTCAAGCCGATTCTCATATTTCTCGAGAAATATGAGAATCGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1364s21c1
Sequence:CCGGGATTAGTACTAAAGGGTTAAACTCGAGTTTAACCCTTTAGTACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-903s21c1
Sequence:CCGGCCCGATATCGTGAAGGTTATCCTCGAGGATAACCTTCACGATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1060s21c1
Sequence:CCGGCCTACGGAGATGACGTTAATCCTCGAGGATTAACGTCATCTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012012.4-3022s21c1
Sequence:CCGGTCAGCCCTGTAAGGGTAAATTCTCGAGAATTTACCCTTACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1120s1c1
Sequence:CCGGCCTTGGAAATAGAGATGTAAACTCGAGTTTACATCTCTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-2335s1c1
Sequence:CCGGGCTCTGTAGGTCTAGTTCTATCTCGAGATAGAACTAGACCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1561s1c1
Sequence:CCGGCCCGTCTAAGATGAGGAATAACTCGAGTTATTCCTCATCTTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-360s1c1
Sequence:CCGGCGATTCTCATATTTGACGGATCTCGAGATCCGTCAAATATGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-664s1c1
Sequence:CCGGCCTCGCATTTGGCTGTAAGAACTCGAGTTCTTACAGCCAAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012012
VALIDATED
EXO1 MISSION shRNA shRNA Plasmid DNA
exonuclease 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-372s21c1
Sequence:GTACCGGGTCAAGCCGATTCTCATATTTCTCGAGAAATATGAGAATCGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1364s21c1
Sequence:CCGGGATTAGTACTAAAGGGTTAAACTCGAGTTTAACCCTTTAGTACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-903s21c1
Sequence:CCGGCCCGATATCGTGAAGGTTATCCTCGAGGATAACCTTCACGATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1060s21c1
Sequence:CCGGCCTACGGAGATGACGTTAATCCTCGAGGATTAACGTCATCTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012012.4-3022s21c1
Sequence:CCGGTCAGCCCTGTAAGGGTAAATTCTCGAGAATTTACCCTTACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1120s1c1
Sequence:CCGGCCTTGGAAATAGAGATGTAAACTCGAGTTTACATCTCTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-2335s1c1
Sequence:CCGGGCTCTGTAGGTCTAGTTCTATCTCGAGATAGAACTAGACCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1561s1c1
Sequence:CCGGCCCGTCTAAGATGAGGAATAACTCGAGTTATTCCTCATCTTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-360s1c1
Sequence:CCGGCGATTCTCATATTTGACGGATCTCGAGATCCGTCAAATATGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-664s1c1
Sequence:CCGGCCTCGCATTTGGCTGTAAGAACTCGAGTTCTTACAGCCAAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012012
VALIDATED
EXO1 MISSION shRNA Lentiviral Transduction Particles
exonuclease 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-372s21c1
Sequence:GTACCGGGTCAAGCCGATTCTCATATTTCTCGAGAAATATGAGAATCGGCTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1364s21c1
Sequence:CCGGGATTAGTACTAAAGGGTTAAACTCGAGTTTAACCCTTTAGTACTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-903s21c1
Sequence:CCGGCCCGATATCGTGAAGGTTATCCTCGAGGATAACCTTCACGATATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_012012.4-1060s21c1
Sequence:CCGGCCTACGGAGATGACGTTAATCCTCGAGGATTAACGTCATCTCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238465    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012012.4-3022s21c1
Sequence:CCGGTCAGCCCTGTAAGGGTAAATTCTCGAGAATTTACCCTTACAGGGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1120s1c1
Sequence:CCGGCCTTGGAAATAGAGATGTAAACTCGAGTTTACATCTCTATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-2335s1c1
Sequence:CCGGGCTCTGTAGGTCTAGTTCTATCTCGAGATAGAACTAGACCTACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-1561s1c1
Sequence:CCGGCCCGTCTAAGATGAGGAATAACTCGAGTTATTCCTCATCTTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-360s1c1
Sequence:CCGGCGATTCTCATATTTGACGGATCTCGAGATCCGTCAAATATGAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012012.2-664s1c1
Sequence:CCGGCCTCGCATTTGGCTGTAAGAACTCGAGTTCTTACAGCCAAATGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks