EMAIL THIS PAGE TO A FRIEND

EXO5

exonuclease 5

92 Gene Product Result for
Synonyms: C1orf176 DEM1 Exo V hExo5
Gene ID:
Mouse(73172) exonuclease 5
Rat(313563) exonuclease 5
sheep(101123508) exonuclease 5
domestic cat(101098806) exonuclease 5
cow(538883) defects in morphology 1 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028457 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028457 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028457 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022774 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022774 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022774 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022774 Rosetta Predictions human pricing
NM_001107973 Rosetta Predictions rat pricing
NM_028457 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022774 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091475 predicted 921
2 SASI_Hs01_00091477 predicted 1060
3 SASI_Hs01_00091478 predicted 429
4 SASI_Hs01_00091479 predicted 558
5 SASI_Hs01_00091480 predicted 1113
6 SASI_Hs01_00091481 predicted 619
7 SASI_Hs01_00091482 predicted 556
8 SASI_Hs01_00091483 predicted 724
9 SASI_Hs01_00091484 predicted 253
10 SASI_Hs02_00356067 predicted 1074
11 SASI_Hs01_00091476 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234115 predicted 767
2 SASI_Rn02_00234116 predicted 1661
3 SASI_Rn02_00234117 predicted 1356
4 SASI_Rn02_00234118 predicted 1422
5 SASI_Rn02_00234119 predicted 1668
6 SASI_Rn02_00234120 predicted 653
7 SASI_Rn02_00234121 predicted 666
8 SASI_Rn02_00234122 predicted 853
9 SASI_Rn02_00234123 predicted 1685
10 SASI_Rn02_00234124 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028457 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187432 predicted 691
2 SASI_Mm01_00187433 predicted 1690
3 SASI_Mm01_00187434 predicted 745
4 SASI_Mm01_00187435 predicted 723
5 SASI_Mm01_00187436 predicted 1232
6 SASI_Mm01_00187437 predicted 1037
7 SASI_Mm01_00187438 predicted 1474
8 SASI_Mm01_00187439 predicted 1292
9 SASI_Mm01_00187440 predicted 640
10 SASI_Mm01_00187441 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028457
VALIDATED
EXO5 MISSION shRNA Bacterial Glycerol Stock
exonuclease 5
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000174693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1663s1c1
Sequence:CCGGGAAATGTTGATCGTTTCTGTTCTCGAGAACAGAAACGATCAACATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-620s1c1
Sequence:CCGGGAAGCCAAAGAATCGGCTGTTCTCGAGAACAGCCGATTCTTTGGCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1009s1c1
Sequence:CCGGCGTCAGAGAGTTTCCAGTGTTCTCGAGAACACTGGAAACTCTCTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-743s1c1
Sequence:CCGGGAGAGATTCCACCTGAAATATCTCGAGATATTTCAGGTGGAATCTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028457
VALIDATED
EXO5 MISSION shRNA shRNA Plasmid DNA
exonuclease 5
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000174693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1663s1c1
Sequence:CCGGGAAATGTTGATCGTTTCTGTTCTCGAGAACAGAAACGATCAACATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000173510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-620s1c1
Sequence:CCGGGAAGCCAAAGAATCGGCTGTTCTCGAGAACAGCCGATTCTTTGGCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1009s1c1
Sequence:CCGGCGTCAGAGAGTTTCCAGTGTTCTCGAGAACACTGGAAACTCTCTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-743s1c1
Sequence:CCGGGAGAGATTCCACCTGAAATATCTCGAGATATTTCAGGTGGAATCTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028457
VALIDATED
EXO5 MISSION shRNA Lentiviral Transduction Particles
exonuclease 5
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000174693    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1663s1c1
Sequence:CCGGGAAATGTTGATCGTTTCTGTTCTCGAGAACAGAAACGATCAACATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000173510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-620s1c1
Sequence:CCGGGAAGCCAAAGAATCGGCTGTTCTCGAGAACAGCCGATTCTTTGGCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-1009s1c1
Sequence:CCGGCGTCAGAGAGTTTCCAGTGTTCTCGAGAACACTGGAAACTCTCTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028457.1-743s1c1
Sequence:CCGGGAGAGATTCCACCTGAAATATCTCGAGATATTTCAGGTGGAATCTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022774
VALIDATED
EXO5 MISSION shRNA Bacterial Glycerol Stock
exonuclease 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-1364s1c1
Sequence:CCGGGCTCCTGTTGTACCTAAGCAACTCGAGTTGCTTAGGTACAACAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-743s1c1
Sequence:CCGGGTGATTGATGAGCTGCACTATCTCGAGATAGTGCAGCTCATCAATCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-269s1c1
Sequence:CCGGGACTCAGAGTTCCTGGAGTTTCTCGAGAAACTCCAGGAACTCTGAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-464s1c1
Sequence:CCGGGCTACTCAGAACTGGTGTGAACTCGAGTTCACACCAGTTCTGAGTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-922s1c1
Sequence:CCGGCCACCACACAAAGTTGTGTCTCTCGAGAGACACAACTTTGTGTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022774
VALIDATED
EXO5 MISSION shRNA shRNA Plasmid DNA
exonuclease 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-1364s1c1
Sequence:CCGGGCTCCTGTTGTACCTAAGCAACTCGAGTTGCTTAGGTACAACAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-743s1c1
Sequence:CCGGGTGATTGATGAGCTGCACTATCTCGAGATAGTGCAGCTCATCAATCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-269s1c1
Sequence:CCGGGACTCAGAGTTCCTGGAGTTTCTCGAGAAACTCCAGGAACTCTGAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-464s1c1
Sequence:CCGGGCTACTCAGAACTGGTGTGAACTCGAGTTCACACCAGTTCTGAGTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-922s1c1
Sequence:CCGGCCACCACACAAAGTTGTGTCTCTCGAGAGACACAACTTTGTGTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022774
VALIDATED
EXO5 MISSION shRNA Lentiviral Transduction Particles
exonuclease 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138842    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-1364s1c1
Sequence:CCGGGCTCCTGTTGTACCTAAGCAACTCGAGTTGCTTAGGTACAACAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-743s1c1
Sequence:CCGGGTGATTGATGAGCTGCACTATCTCGAGATAGTGCAGCTCATCAATCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-269s1c1
Sequence:CCGGGACTCAGAGTTCCTGGAGTTTCTCGAGAAACTCCAGGAACTCTGAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-464s1c1
Sequence:CCGGGCTACTCAGAACTGGTGTGAACTCGAGTTCACACCAGTTCTGAGTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_022774.1-922s1c1
Sequence:CCGGCCACCACACAAAGTTGTGTCTCTCGAGAGACACAACTTTGTGTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)