EMAIL THIS PAGE TO A FRIEND

EXOC1

exocyst complex component 1

155 Gene Product Result for
Synonyms: BM-102 SEC3 SEC3L1 SEC3P
UniProtKB ID: Q9NV70, Q504V4, Q8WUE7, Q96T15, Q9NZE4
Gene ID:
Human(55763) Summary: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Mouse(69940) exocyst complex component 1
Rat(305287) exocyst complex component 1
Zebrafish(322338) exocyst complex component 1
cow(504440) exocyst complex component 1
Horse(100059087) exocyst complex component 1
dog(475149) exocyst complex component 1
chicken(422747) exocyst complex component 1
Domestic Rabbit(100348845) exocyst complex component 1
domestic guinea pig(100728990) exocyst complex component 1
naked mole-rat(101724313) exocyst complex component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082871 MISSION® esiRNA esiRNA human EXOC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024924 Rosetta Predictions human pricing
NM_018261 Rosetta Predictions human pricing
NM_178237 Rosetta Predictions human pricing
NM_001024770 Rosetta Predictions rat pricing
NM_027270 Rosetta Predictions mouse pricing
XM_001052151 Rosetta Predictions mouse pricing
XM_973473 Rosetta Predictions mouse pricing
XM_973518 Rosetta Predictions mouse pricing
XM_973578 Rosetta Predictions mouse pricing
XM_973619 Rosetta Predictions mouse pricing
XM_973646 Rosetta Predictions mouse pricing
XM_973689 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024924 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307264 predicted 1077
2 SASI_Hs01_00050822 predicted 1310
3 SASI_Hs02_00307265 predicted 2987
4 SASI_Hs01_00050824 predicted 514
5 SASI_Hs01_00050825 predicted 656
6 SASI_Hs01_00050826 predicted 845
7 SASI_Hs01_00050827 predicted 2957
8 SASI_Hs02_00307266 predicted 2787
9 SASI_Hs01_00050829 predicted 3035
10 SASI_Hs02_00307267 predicted 570
11 SASI_Hs01_00050820 predicted 1097
12 SASI_Hs01_00050821 predicted 1087
13 SASI_Hs01_00050823 predicted 810
14 SASI_Hs01_00050828 predicted 2171
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351624 predicted 917
2 SASI_Hs01_00234540 predicted 1157
3 SASI_Hs02_00351625 predicted 2829
4 SASI_Hs01_00234542 predicted 351
5 SASI_Hs01_00234543 predicted 501
6 SASI_Hs01_00234544 predicted 682
7 SASI_Hs01_00234545 predicted 2805
8 SASI_Hs02_00351626 predicted 2637
9 SASI_Hs01_00234547 predicted 2882
10 SASI_Hs02_00351627 predicted 418
11 SASI_Hs01_00234538 predicted 933
12 SASI_Hs01_00234539 predicted 934
13 SASI_Hs01_00234541 predicted 656
14 SASI_Hs01_00234546 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369617 predicted 921
2 SASI_Hs01_00082002 predicted 1154
3 SASI_Hs02_00369618 predicted 2789
4 SASI_Hs01_00082004 predicted 358
5 SASI_Hs01_00082005 predicted 497
6 SASI_Hs01_00082006 predicted 684
7 SASI_Hs01_00082007 predicted 2760
8 SASI_Hs02_00369619 predicted 2592
9 SASI_Hs01_00082009 predicted 2832
10 SASI_Hs02_00369620 predicted 411
11 SASI_Hs01_00082000 predicted 932
12 SASI_Hs01_00082001 predicted 935
13 SASI_Hs01_00082003 predicted 660
14 SASI_Hs01_00082008 predicted 1972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024770 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048954 predicted 1844
2 SASI_Rn02_00202655 predicted 1532
3 SASI_Rn01_00048955 predicted 1350
4 SASI_Rn01_00048956 predicted 618
5 SASI_Rn01_00048957 predicted 1643
6 SASI_Rn01_00048958 predicted 2017
7 SASI_Rn02_00202656 predicted 737
8 SASI_Rn01_00048960 predicted 290
9 SASI_Rn01_00048961 predicted 633
10 SASI_Rn02_00202657 predicted 907
11 SASI_Rn01_00048959 predicted 814
12 SASI_Rn01_00048962 predicted 1303
13 SASI_Rn01_00048963 predicted 814
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027270 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00069432 predicted 1687
2 SASI_Mm01_00069434 predicted 851
3 SASI_Mm02_00331850 predicted 1576
4 SASI_Mm01_00069435 predicted 1402
5 SASI_Mm02_00331851 predicted 554
6 SASI_Mm01_00069436 predicted 955
7 SASI_Mm01_00069437 predicted 1780
8 SASI_Mm01_00069438 predicted 2062
9 SASI_Mm01_00069439 predicted 2813
10 SASI_Mm01_00069440 predicted 429
11 SASI_Mm01_00069433 predicted 2909
12 SASI_Mm01_00069441 predicted 1946
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001052151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236513 predicted 2927
2 SASI_Mm01_00236514 predicted 873
3 SASI_Mm01_00236515 predicted 1917
4 SASI_Mm01_00236516 predicted 977
5 SASI_Mm01_00236517 predicted 1797
6 SASI_Mm01_00236518 predicted 1945
7 SASI_Mm01_00236519 predicted 2079
8 SASI_Mm01_00236520 predicted 2831
9 SASI_Mm01_00236521 predicted 910
10 SASI_Mm01_00236522 predicted 2145
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00248369 predicted 603
2 SASI_Mm01_00248370 predicted 319
3 SASI_Mm01_00248371 predicted 337
4 SASI_Mm01_00248372 predicted 238
5 SASI_Mm01_00248373 predicted 637
6 SASI_Mm01_00248374 predicted 485
7 SASI_Mm01_00248375 predicted 572
8 SASI_Mm01_00248376 predicted 409
9 SASI_Mm01_00248377 predicted 232
10 SASI_Mm01_00248378 predicted 485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246262 predicted 312
2 SASI_Mm01_00246263 predicted 334
3 SASI_Mm01_00246264 predicted 311
4 SASI_Mm01_00246265 predicted 337
5 SASI_Mm01_00246266 predicted 310
6 SASI_Mm01_00246267 predicted 327
7 SASI_Mm01_00246268 predicted 307
8 SASI_Mm01_00246269 predicted 331
9 SASI_Mm01_00246270 predicted 312
10 SASI_Mm01_00246271 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232405 predicted 969
2 SASI_Mm01_00232406 predicted 1078
3 SASI_Mm01_00232407 predicted 750
4 SASI_Mm01_00232408 predicted 271
5 SASI_Mm01_00232409 predicted 1107
6 SASI_Mm01_00232410 predicted 977
7 SASI_Mm01_00232411 predicted 296
8 SASI_Mm01_00232412 predicted 874
9 SASI_Mm01_00232413 predicted 953
10 SASI_Mm01_00232414 predicted 522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973619 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208771 predicted 1216
2 SASI_Mm01_00208772 predicted 2439
3 SASI_Mm01_00208773 predicted 383
4 SASI_Mm01_00208774 predicted 927
5 SASI_Mm01_00208775 predicted 480
6 SASI_Mm01_00208776 predicted 1304
7 SASI_Mm01_00208777 predicted 1453
8 SASI_Mm01_00208778 predicted 1584
9 SASI_Mm01_00208779 predicted 2331
10 SASI_Mm01_00208780 predicted 1477
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00213455 predicted 2865
2 SASI_Mm01_00213456 predicted 847
3 SASI_Mm01_00213457 predicted 1844
4 SASI_Mm01_00213458 predicted 956
5 SASI_Mm01_00213459 predicted 1725
6 SASI_Mm01_00213460 predicted 1882
7 SASI_Mm01_00213461 predicted 2010
8 SASI_Mm01_00213462 predicted 2764
9 SASI_Mm01_00213463 predicted 897
10 SASI_Mm01_00213464 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_973689 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00262995 predicted 2910
2 SASI_Mm01_00262996 predicted 1946
3 SASI_Mm01_00262997 predicted 845
4 SASI_Mm01_00262998 predicted 1887
5 SASI_Mm01_00262999 predicted 956
6 SASI_Mm01_00263000 predicted 1777
7 SASI_Mm01_00263001 predicted 1932
8 SASI_Mm01_00263002 predicted 2054
9 SASI_Mm01_00263003 predicted 2810
10 SASI_Mm01_00263004 predicted 895
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018261
VALIDATED
EXOC1 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000131016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-756s1c1
Sequence:CCGGCCAGTCAATCATGGCATCTGACTCGAGTCAGATGCCATGATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-3152s1c1
Sequence:CCGGGCATTTGGAGTTCTTCAGCTTCTCGAGAAGCTGAAGAACTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1617s1c1
Sequence:CCGGCCTGTTGGATATGGGAAACATCTCGAGATGTTTCCCATATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018261.2-1388s1c1
Sequence:CCGGCCCGACTATATGAAAGAGAAACTCGAGTTTCTCTTTCATATAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-757s1c1
Sequence:CCGGCAGTCAATCATGGCATCTGAACTCGAGTTCAGATGCCATGATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1918s1c1
Sequence:CCGGCCAGAGCTGAACAACCTAATTCTCGAGAATTAGGTTGTTCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-1321s1c1
Sequence:CCGGGAGTGGCTAAAGAGTACAGATCTCGAGATCTGTACTCTTTAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018261.2-3020s1c1
Sequence:CCGGGCCCTATAGGTTGCATACTAACTCGAGTTAGTATGCAACCTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-904s1c1
Sequence:CCGGGAAAGCAACCACCTAATTCATCTCGAGATGAATTAGGTGGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-1817s1c1
Sequence:CCGGGAACATTATCACGGCAACATACTCGAGTATGTTGCCGTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018261.2-3161s1c1
Sequence:CCGGGTTCTTCAGCTTTCACTACTTCTCGAGAAGTAGTGAAAGCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1564s21c1
Sequence:CCGGGATCTACTTCTAGTCTAAATACTCGAGTATTTAGACTAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-630s21c1
Sequence:CCGGGATGAATACCAAGAGTTAAATCTCGAGATTTAACTCTTGGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1302s21c1
Sequence:CCGGCATAGAGATTTGCTCCGATATCTCGAGATATCGGAGCAAATCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1893s21c1
Sequence:CCGGATCCGCCAAATGATGATTAAACTCGAGTTTAATCATCATTTGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-2097s21c1
Sequence:CCGGTTTGACAAATGCATTAGTAACCTCGAGGTTACTAATGCATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-657s21c1
Sequence:CCGGGAAGAACAGGATATCGAAATACTCGAGTATTTCGATATCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018261
VALIDATED
EXOC1 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000131016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-756s1c1
Sequence:CCGGCCAGTCAATCATGGCATCTGACTCGAGTCAGATGCCATGATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-3152s1c1
Sequence:CCGGGCATTTGGAGTTCTTCAGCTTCTCGAGAAGCTGAAGAACTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1617s1c1
Sequence:CCGGCCTGTTGGATATGGGAAACATCTCGAGATGTTTCCCATATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018261.2-1388s1c1
Sequence:CCGGCCCGACTATATGAAAGAGAAACTCGAGTTTCTCTTTCATATAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-757s1c1
Sequence:CCGGCAGTCAATCATGGCATCTGAACTCGAGTTCAGATGCCATGATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1918s1c1
Sequence:CCGGCCAGAGCTGAACAACCTAATTCTCGAGAATTAGGTTGTTCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-1321s1c1
Sequence:CCGGGAGTGGCTAAAGAGTACAGATCTCGAGATCTGTACTCTTTAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018261.2-3020s1c1
Sequence:CCGGGCCCTATAGGTTGCATACTAACTCGAGTTAGTATGCAACCTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-904s1c1
Sequence:CCGGGAAAGCAACCACCTAATTCATCTCGAGATGAATTAGGTGGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-1817s1c1
Sequence:CCGGGAACATTATCACGGCAACATACTCGAGTATGTTGCCGTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018261.2-3161s1c1
Sequence:CCGGGTTCTTCAGCTTTCACTACTTCTCGAGAAGTAGTGAAAGCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1564s21c1
Sequence:CCGGGATCTACTTCTAGTCTAAATACTCGAGTATTTAGACTAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-630s21c1
Sequence:CCGGGATGAATACCAAGAGTTAAATCTCGAGATTTAACTCTTGGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1302s21c1
Sequence:CCGGCATAGAGATTTGCTCCGATATCTCGAGATATCGGAGCAAATCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1893s21c1
Sequence:CCGGATCCGCCAAATGATGATTAAACTCGAGTTTAATCATCATTTGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-2097s21c1
Sequence:CCGGTTTGACAAATGCATTAGTAACCTCGAGGTTACTAATGCATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-657s21c1
Sequence:CCGGGAAGAACAGGATATCGAAATACTCGAGTATTTCGATATCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018261
VALIDATED
EXOC1 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000131016    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-756s1c1
Sequence:CCGGCCAGTCAATCATGGCATCTGACTCGAGTCAGATGCCATGATTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130728    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-3152s1c1
Sequence:CCGGGCATTTGGAGTTCTTCAGCTTCTCGAGAAGCTGAAGAACTCCAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1617s1c1
Sequence:CCGGCCTGTTGGATATGGGAAACATCTCGAGATGTTTCCCATATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018261.2-1388s1c1
Sequence:CCGGCCCGACTATATGAAAGAGAAACTCGAGTTTCTCTTTCATATAGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127517    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-757s1c1
Sequence:CCGGCAGTCAATCATGGCATCTGAACTCGAGTTCAGATGCCATGATTGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127656    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018261.2-1918s1c1
Sequence:CCGGCCAGAGCTGAACAACCTAATTCTCGAGAATTAGGTTGTTCAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127717    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018261.2-1321s1c1
Sequence:CCGGGAGTGGCTAAAGAGTACAGATCTCGAGATCTGTACTCTTTAGCCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018261.2-3020s1c1
Sequence:CCGGGCCCTATAGGTTGCATACTAACTCGAGTTAGTATGCAACCTATAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-904s1c1
Sequence:CCGGGAAAGCAACCACCTAATTCATCTCGAGATGAATTAGGTGGTTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018261.2-1817s1c1
Sequence:CCGGGAACATTATCACGGCAACATACTCGAGTATGTTGCCGTGATAATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018261.2-3161s1c1
Sequence:CCGGGTTCTTCAGCTTTCACTACTTCTCGAGAAGTAGTGAAAGCTGAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1564s21c1
Sequence:CCGGGATCTACTTCTAGTCTAAATACTCGAGTATTTAGACTAGAAGTAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-630s21c1
Sequence:CCGGGATGAATACCAAGAGTTAAATCTCGAGATTTAACTCTTGGTATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1302s21c1
Sequence:CCGGCATAGAGATTTGCTCCGATATCTCGAGATATCGGAGCAAATCTCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-1893s21c1
Sequence:CCGGATCCGCCAAATGATGATTAAACTCGAGTTTAATCATCATTTGGCGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-2097s21c1
Sequence:CCGGTTTGACAAATGCATTAGTAACCTCGAGGTTACTAATGCATTTGTCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018261.3-657s21c1
Sequence:CCGGGAAGAACAGGATATCGAAATACTCGAGTATTTCGATATCCTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027270
EXOC1 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000254148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2811s21c1
Sequence:CCGGTCAGGACATTCTGGATTATTGCTCGAGCAATAATCCAGAATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027270.1-3193s21c1
Sequence:CCGGATGTGCCAGTTGCTCACAAATCTCGAGATTTGTGAGCAACTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-1834s21c1
Sequence:CCGGCTGGATGGAGGCTCGTTATTACTCGAGTAATAACGAGCCTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2716s21c1
Sequence:CCGGTCCATGCAAGATGAGTTTATACTCGAGTATAAACTCATCTTGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027270
EXOC1 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000254148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2811s21c1
Sequence:CCGGTCAGGACATTCTGGATTATTGCTCGAGCAATAATCCAGAATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027270.1-3193s21c1
Sequence:CCGGATGTGCCAGTTGCTCACAAATCTCGAGATTTGTGAGCAACTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-1834s21c1
Sequence:CCGGCTGGATGGAGGCTCGTTATTACTCGAGTAATAACGAGCCTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2716s21c1
Sequence:CCGGTCCATGCAAGATGAGTTTATACTCGAGTATAAACTCATCTTGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027270
EXOC1 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000254148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2811s21c1
Sequence:CCGGTCAGGACATTCTGGATTATTGCTCGAGCAATAATCCAGAATGTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027270.1-3193s21c1
Sequence:CCGGATGTGCCAGTTGCTCACAAATCTCGAGATTTGTGAGCAACTGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-1834s21c1
Sequence:CCGGCTGGATGGAGGCTCGTTATTACTCGAGTAATAACGAGCCTCCATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027270.1-2716s21c1
Sequence:CCGGTCCATGCAAGATGAGTTTATACTCGAGTATAAACTCATCTTGCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks