EMAIL THIS PAGE TO A FRIEND

EXOC2

exocyst complex component 2

53 Gene Product Result for
Synonyms: SEC5 SEC5L1 Sec5p
UniProtKB ID: Q96KP1, Q5JPC8, Q96AN6, Q9NUZ8, Q9UJM7
Gene ID:
Human(55770) Summary: The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(66482) exocyst complex component 2
Rat(171455) exocyst complex component 2
naked mole-rat(101705272) exocyst complex component 2
domestic guinea pig(100714267) exocyst complex component 2
sheep(101110975) exocyst complex component 2
Domestic Rabbit(100354138) exocyst complex component 2
Zebrafish(100004870) exocyst complex component 2
chicken(420889) exocyst complex component 2
dog(478696) exocyst complex component 2
domestic cat(101089188) exocyst complex component 2
cow(513431) exocyst complex component 2
Horse(100049898) exocyst complex component 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018303 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018303 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018303 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018303 Rosetta Predictions human pricing
NM_134414 Rosetta Predictions rat pricing
NM_025588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018303 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191755 predicted 1418
2 SASI_Hs01_00191756 predicted 944
3 SASI_Hs01_00191757 predicted 2366
4 SASI_Hs01_00191758 predicted 2276
5 SASI_Hs02_00351713 predicted 500
6 SASI_Hs01_00191759 predicted 2965
7 SASI_Hs01_00191760 predicted 2183
8 SASI_Hs01_00191761 predicted 1800
9 SASI_Hs02_00351714 predicted 1846
10 SASI_Hs02_00351715 predicted 2974
11 SASI_Hs01_00191754 predicted 1581
12 SASI_Hs01_00191762 predicted 2979
13 SASI_Hs01_00191763 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134414 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074566 predicted 1146
2 SASI_Rn01_00074567 predicted 366
3 SASI_Rn01_00074568 predicted 1009
4 SASI_Rn01_00074569 predicted 1101
5 SASI_Rn02_00268010 predicted 3113
6 SASI_Rn01_00074570 predicted 1243
7 SASI_Rn02_00268011 predicted 687
8 SASI_Rn01_00074573 predicted 2307
9 SASI_Rn01_00074574 predicted 704
10 SASI_Rn01_00074575 predicted 2583
11 SASI_Rn01_00074571 predicted 1410
12 SASI_Rn01_00074572 predicted 1057
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119893 predicted 949
2 SASI_Mm01_00119894 predicted 2427
3 SASI_Mm01_00119895 predicted 1085
4 SASI_Mm01_00119896 predicted 2750
5 SASI_Mm01_00119897 predicted 2324
6 SASI_Mm01_00119898 predicted 1748
7 SASI_Mm01_00119899 predicted 1805
8 SASI_Mm01_00119900 predicted 1401
9 SASI_Mm01_00119901 predicted 539
10 SASI_Mm01_00119902 predicted 1881
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018303
VALIDATED
EXOC2 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-956s21c1
Sequence:CCGGCAATGTGCTTCAGCGATTTAACTCGAGTTAAATCGCTGAAGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018303.4-3229s21c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018303.4-1915s21c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-636s21c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-1164s21c1
Sequence:CCGGCTTGAGACACCATCAACTTTACTCGAGTAAAGTTGATGGTGTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-3229s1c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-1915s1c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018303.4-2464s1c1
Sequence:CCGGCTGGAATTTATGCAGGATATTCTCGAGAATATCCTGCATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-2110s1c1
Sequence:CCGGGCATCAATATAATGCAGGTTTCTCGAGAAACCTGCATTATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-636s1c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018303
VALIDATED
EXOC2 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-956s21c1
Sequence:CCGGCAATGTGCTTCAGCGATTTAACTCGAGTTAAATCGCTGAAGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018303.4-3229s21c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018303.4-1915s21c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-636s21c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-1164s21c1
Sequence:CCGGCTTGAGACACCATCAACTTTACTCGAGTAAAGTTGATGGTGTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-3229s1c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-1915s1c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018303.4-2464s1c1
Sequence:CCGGCTGGAATTTATGCAGGATATTCTCGAGAATATCCTGCATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-2110s1c1
Sequence:CCGGGCATCAATATAATGCAGGTTTCTCGAGAAACCTGCATTATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-636s1c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018303
VALIDATED
EXOC2 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-956s21c1
Sequence:CCGGCAATGTGCTTCAGCGATTTAACTCGAGTTAAATCGCTGAAGCACATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289960    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018303.4-3229s21c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018303.4-1915s21c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-636s21c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018303.4-1164s21c1
Sequence:CCGGCTTGAGACACCATCAACTTTACTCGAGTAAAGTTGATGGTGTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116102    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-3229s1c1
Sequence:CCGGCGTGGCACATATTGAAGCATTCTCGAGAATGCTTCAATATGTGCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-1915s1c1
Sequence:CCGGCGGCGGAAGAAATAAAGAGATCTCGAGATCTCTTTATTTCTTCCGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018303.4-2464s1c1
Sequence:CCGGCTGGAATTTATGCAGGATATTCTCGAGAATATCCTGCATAAATTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-2110s1c1
Sequence:CCGGGCATCAATATAATGCAGGTTTCTCGAGAAACCTGCATTATATTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_018303.4-636s1c1
Sequence:CCGGGCCTGGTATCTTATAGAGAATCTCGAGATTCTCTATAAGATACCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025588
EXOC2 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000195832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-2435s1c1
Sequence:CCGGCGCAGGCTACTTTGATTGGAACTCGAGTTCCAATCAAAGTAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-597s1c1
Sequence:CCGGGCCTGGTATCTCATAGAGAATCTCGAGATTCTCTATGAGATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025588.2-3311s1c1
Sequence:CCGGCCACCCTGTTTCTGTAAAGAACTCGAGTTCTTTACAGAAACAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-1878s1c1
Sequence:CCGGGCCGAAGAGATAAAGAGATTACTCGAGTAATCTCTTTATCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025588
EXOC2 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000195832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-2435s1c1
Sequence:CCGGCGCAGGCTACTTTGATTGGAACTCGAGTTCCAATCAAAGTAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-597s1c1
Sequence:CCGGGCCTGGTATCTCATAGAGAATCTCGAGATTCTCTATGAGATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025588.2-3311s1c1
Sequence:CCGGCCACCCTGTTTCTGTAAAGAACTCGAGTTCTTTACAGAAACAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-1878s1c1
Sequence:CCGGGCCGAAGAGATAAAGAGATTACTCGAGTAATCTCTTTATCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025588
EXOC2 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000195832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-2435s1c1
Sequence:CCGGCGCAGGCTACTTTGATTGGAACTCGAGTTCCAATCAAAGTAGCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-597s1c1
Sequence:CCGGGCCTGGTATCTCATAGAGAATCTCGAGATTCTCTATGAGATACCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025588.2-3311s1c1
Sequence:CCGGCCACCCTGTTTCTGTAAAGAACTCGAGTTCTTTACAGAAACAGGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025588.2-1878s1c1
Sequence:CCGGGCCGAAGAGATAAAGAGATTACTCGAGTAATCTCTTTATCTCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks