EMAIL THIS PAGE TO A FRIEND

EXOC3

exocyst complex component 3

51 Gene Product Result for
Synonyms: SEC6 SEC6L1 Sec6p
UniProtKB ID: O60645, Q6P2E8, Q8TEN6, Q8WUW0, Q96DI4
Gene ID:
Human(11336) Summary: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Mouse(211446) exocyst complex component 3
Rat(252881) exocyst complex component 3
Zebrafish(334015) exocyst complex component 3
chicken(420987) exocyst complex component 3
cow(513138) exocyst complex component 3
Horse(100057355) exocyst complex component 3
dog(478633) exocyst complex component 3
domestic cat(101096289) exocyst complex component 3
sheep(101103266) exocyst complex component 3
domestic guinea pig(100716122) exocyst complex component 3
naked mole-rat(101699912) exocyst complex component 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007277 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007277 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007277 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177333 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177333 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177333 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007277 Rosetta Predictions human pricing
NM_001024964 Rosetta Predictions rat pricing
NM_177333 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007277 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127055 predicted 1629
2 SASI_Hs01_00127056 predicted 753
3 SASI_Hs01_00127057 predicted 1815
4 SASI_Hs01_00127058 predicted 1122
5 SASI_Hs01_00127059 predicted 1430
6 SASI_Hs01_00127061 predicted 2178
7 SASI_Hs01_00127062 predicted 328
8 SASI_Hs01_00127063 predicted 849
9 SASI_Hs01_00127064 predicted 2131
10 SASI_Hs02_00343332 predicted 919
11 SASI_Hs01_00127060 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202812 predicted 1378
2 SASI_Rn01_00117680 predicted 272
3 SASI_Rn01_00117681 predicted 1727
4 SASI_Rn01_00117682 predicted 825
5 SASI_Rn01_00117683 predicted 2106
6 SASI_Rn01_00117684 predicted 1392
7 SASI_Rn01_00117685 predicted 1954
8 SASI_Rn01_00117688 predicted 1442
9 SASI_Rn01_00117689 predicted 1322
10 SASI_Rn02_00202813 predicted 1441
11 SASI_Rn01_00117686 predicted 1347
12 SASI_Rn01_00117687 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177333 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057804 predicted 355
2 SASI_Mm01_00057805 predicted 1433
3 SASI_Mm01_00057806 predicted 1395
4 SASI_Mm02_00347446 predicted 2122
5 SASI_Mm01_00057807 predicted 1350
6 SASI_Mm01_00057808 predicted 1408
7 SASI_Mm01_00057809 predicted 1534
8 SASI_Mm01_00057810 predicted 222
9 SASI_Mm01_00057812 predicted 268
10 SASI_Mm01_00057813 predicted 666
11 SASI_Mm01_00057811 predicted 1367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007277
VALIDATED
EXOC3 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007277.3-2567s1c1
Sequence:CCGGTGCTTGTTTGTTGCAGTGGTTCTCGAGAACCACTGCAACAAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1578s1c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1402s1c1
Sequence:CCGGGCTGCTCAGATAAGTGAAGATCTCGAGATCTTCACTTATCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1101s1c1
Sequence:CCGGCCTCTTGACGTGGGTCTTAAACTCGAGTTTAAGACCCACGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-808s1c1
Sequence:CCGGCCCAAGAATTGGAAGGAGAAACTCGAGTTTCTCCTTCCAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-2466s21c1
Sequence:CCGGTAGCTGCACGGCCTGTCTTTACTCGAGTAAAGACAGGCCGTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1619s21c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1848s21c1
Sequence:CCGGGTCACCGTGGAAGACTATTTCCTCGAGGAAATAGTCTTCCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1801s21c1
Sequence:CCGGTGACGAAGAAGTGGCTATTAGCTCGAGCTAATAGCCACTTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007277.4-328s21c1
Sequence:CCGGACGCCCTGAATGACGTCAAAGCTCGAGCTTTGACGTCATTCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007277
VALIDATED
EXOC3 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007277.3-2567s1c1
Sequence:CCGGTGCTTGTTTGTTGCAGTGGTTCTCGAGAACCACTGCAACAAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1578s1c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1402s1c1
Sequence:CCGGGCTGCTCAGATAAGTGAAGATCTCGAGATCTTCACTTATCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1101s1c1
Sequence:CCGGCCTCTTGACGTGGGTCTTAAACTCGAGTTTAAGACCCACGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-808s1c1
Sequence:CCGGCCCAAGAATTGGAAGGAGAAACTCGAGTTTCTCCTTCCAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-2466s21c1
Sequence:CCGGTAGCTGCACGGCCTGTCTTTACTCGAGTAAAGACAGGCCGTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1619s21c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1848s21c1
Sequence:CCGGGTCACCGTGGAAGACTATTTCCTCGAGGAAATAGTCTTCCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1801s21c1
Sequence:CCGGTGACGAAGAAGTGGCTATTAGCTCGAGCTAATAGCCACTTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007277.4-328s21c1
Sequence:CCGGACGCCCTGAATGACGTCAAAGCTCGAGCTTTGACGTCATTCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007277
VALIDATED
EXOC3 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007277.3-2567s1c1
Sequence:CCGGTGCTTGTTTGTTGCAGTGGTTCTCGAGAACCACTGCAACAAACAAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074304    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1578s1c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074306    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1402s1c1
Sequence:CCGGGCTGCTCAGATAAGTGAAGATCTCGAGATCTTCACTTATCTGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-1101s1c1
Sequence:CCGGCCTCTTGACGTGGGTCTTAAACTCGAGTTTAAGACCCACGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_007277.3-808s1c1
Sequence:CCGGCCCAAGAATTGGAAGGAGAAACTCGAGTTTCTCCTTCCAATTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-2466s21c1
Sequence:CCGGTAGCTGCACGGCCTGTCTTTACTCGAGTAAAGACAGGCCGTGCAGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1619s21c1
Sequence:CCGGCCAGACCTTCAAGGAATCCATCTCGAGATGGATTCCTTGAAGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1848s21c1
Sequence:CCGGGTCACCGTGGAAGACTATTTCCTCGAGGAAATAGTCTTCCACGGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_007277.4-1801s21c1
Sequence:CCGGTGACGAAGAAGTGGCTATTAGCTCGAGCTAATAGCCACTTCTTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007277.4-328s21c1
Sequence:CCGGACGCCCTGAATGACGTCAAAGCTCGAGCTTTGACGTCATTCAGGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177333
VALIDATED
EXOC3 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1099s1c1
Sequence:CCGGCCTCTTGACATGGGTCCTAAACTCGAGTTTAGGACCCATGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1910s1c1
Sequence:CCGGGCTGTCATGCAGAAGCGTATTCTCGAGAATACGCTTCTGCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1531s1c1
Sequence:CCGGCCCACACTGTTATGTGCAGTACTCGAGTACTGCACATAACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-717s1c1
Sequence:CCGGCCGTGGTCAGAATCATTGAAACTCGAGTTTCAATGATTCTGACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1401s1c1
Sequence:CCGGCTGCTCAAATAAGTGAAGATTCTCGAGAATCTTCACTTATTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177333
VALIDATED
EXOC3 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1099s1c1
Sequence:CCGGCCTCTTGACATGGGTCCTAAACTCGAGTTTAGGACCCATGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1910s1c1
Sequence:CCGGGCTGTCATGCAGAAGCGTATTCTCGAGAATACGCTTCTGCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1531s1c1
Sequence:CCGGCCCACACTGTTATGTGCAGTACTCGAGTACTGCACATAACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-717s1c1
Sequence:CCGGCCGTGGTCAGAATCATTGAAACTCGAGTTTCAATGATTCTGACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1401s1c1
Sequence:CCGGCTGCTCAAATAAGTGAAGATTCTCGAGAATCTTCACTTATTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177333
VALIDATED
EXOC3 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1099s1c1
Sequence:CCGGCCTCTTGACATGGGTCCTAAACTCGAGTTTAGGACCCATGTCAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1910s1c1
Sequence:CCGGGCTGTCATGCAGAAGCGTATTCTCGAGAATACGCTTCTGCATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177333.2-1531s1c1
Sequence:CCGGCCCACACTGTTATGTGCAGTACTCGAGTACTGCACATAACAGTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-717s1c1
Sequence:CCGGCCGTGGTCAGAATCATTGAAACTCGAGTTTCAATGATTCTGACCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177333.2-1401s1c1
Sequence:CCGGCTGCTCAAATAAGTGAAGATTCTCGAGAATCTTCACTTATTTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks