EMAIL THIS PAGE TO A FRIEND

EXOC3L1

exocyst complex component 3-like 1

31 Gene Product Result for
Synonyms: EXOC3L
UniProtKB ID: Q86VI1, A8K7I9, Q8NAD2, Q8TEN2
Gene ID:
Rat(291961) exocyst complex component 3-like 1
sheep(101112248) exocyst complex component 3-like 1
naked mole-rat(101718873) exocyst complex component 3-like 1
domestic guinea pig(100735658) exocyst complex component 3-like 1
Zebrafish(567832) exocyst complex component 3-like 1
chicken(769364) exocyst complex component 3-like 1
cow(526306) exocyst complex component 3-like 1
domestic cat(101088289) exocyst complex component 3-like 1
dog(489764) exocyst complex component 3-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178516 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178516 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178516 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU147071 MISSION® esiRNA esiRNA human EXOC3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178516 Rosetta Predictions human pricing
NM_001106178 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178516 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369755 predicted 1368
2 SASI_Hs02_00369756 predicted 542
3 SASI_Hs01_00029028 predicted 1621
4 SASI_Hs01_00029029 predicted 700
5 SASI_Hs01_00029030 predicted 681
6 SASI_Hs01_00029031 predicted 431
7 SASI_Hs01_00029034 predicted 1814
8 SASI_Hs01_00029035 predicted 692
9 SASI_Hs01_00029036 predicted 431
10 SASI_Hs01_00029037 predicted 1870
11 SASI_Hs01_00029032 predicted 2731
12 SASI_Hs01_00029033 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106178 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216398 predicted 1552
2 SASI_Rn02_00216399 predicted 1732
3 SASI_Rn02_00216400 predicted 1557
4 SASI_Rn02_00216401 predicted 1693
5 SASI_Rn02_00216402 predicted 918
6 SASI_Rn02_00216403 predicted 649
7 SASI_Rn02_00216404 predicted 1623
8 SASI_Rn02_00216405 predicted 424
9 SASI_Rn02_00216406 predicted 577
10 SASI_Rn02_00216407 predicted 1615
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178516
EXOC3L1 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3-like 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1602s1c1
Sequence:CCGGCAGTGATGCTCTGATCCGATTCTCGAGAATCGGATCAGAGCATCACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-658s1c1
Sequence:CCGGCACACACAGACTCTGATTGATCTCGAGATCAATCAGAGTCTGTGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-681s1c1
Sequence:CCGGCCAACAGTTCTTGGAGGCATACTCGAGTATGCCTCCAAGAACTGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178516.2-3288s1c1
Sequence:CCGGCCTGATGGAAAGAGTCCAGTACTCGAGTACTGGACTCTTTCCATCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1315s1c1
Sequence:CCGGCTTCTGACCTTGGAGAACATTCTCGAGAATGTTCTCCAAGGTCAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178516.2-664s1c1
Sequence:CCGGCAGACTCTGATTGATGGCCAACTCGAGTTGGCCATCAATCAGAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1811s21c1
Sequence:CCGGGAGTTGCAGAGGAGGATCTACCTCGAGGTAGATCCTCCTCTGCAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1169s21c1
Sequence:CCGGCACACGCTGCATAGTGGTTTGCTCGAGCAAACCACTATGCAGCGTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1144s21c1
Sequence:CCGGGTACAACGTGGTCCAGCTATGCTCGAGCATAGCTGGACCACGTTGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1688s21c1
Sequence:CCGGCATTACGTGCCCTACCTACTGCTCGAGCAGTAGGTAGGGCACGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-2463s21c1
Sequence:CCGGCCCTGCTGCTCGCAGAATAAACTCGAGTTTATTCTGCGAGCAGCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178516
EXOC3L1 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3-like 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1602s1c1
Sequence:CCGGCAGTGATGCTCTGATCCGATTCTCGAGAATCGGATCAGAGCATCACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-658s1c1
Sequence:CCGGCACACACAGACTCTGATTGATCTCGAGATCAATCAGAGTCTGTGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-681s1c1
Sequence:CCGGCCAACAGTTCTTGGAGGCATACTCGAGTATGCCTCCAAGAACTGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178516.2-3288s1c1
Sequence:CCGGCCTGATGGAAAGAGTCCAGTACTCGAGTACTGGACTCTTTCCATCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1315s1c1
Sequence:CCGGCTTCTGACCTTGGAGAACATTCTCGAGAATGTTCTCCAAGGTCAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178516.2-664s1c1
Sequence:CCGGCAGACTCTGATTGATGGCCAACTCGAGTTGGCCATCAATCAGAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1811s21c1
Sequence:CCGGGAGTTGCAGAGGAGGATCTACCTCGAGGTAGATCCTCCTCTGCAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1169s21c1
Sequence:CCGGCACACGCTGCATAGTGGTTTGCTCGAGCAAACCACTATGCAGCGTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1144s21c1
Sequence:CCGGGTACAACGTGGTCCAGCTATGCTCGAGCATAGCTGGACCACGTTGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1688s21c1
Sequence:CCGGCATTACGTGCCCTACCTACTGCTCGAGCAGTAGGTAGGGCACGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-2463s21c1
Sequence:CCGGCCCTGCTGCTCGCAGAATAAACTCGAGTTTATTCTGCGAGCAGCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178516
EXOC3L1 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3-like 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137277    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1602s1c1
Sequence:CCGGCAGTGATGCTCTGATCCGATTCTCGAGAATCGGATCAGAGCATCACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-658s1c1
Sequence:CCGGCACACACAGACTCTGATTGATCTCGAGATCAATCAGAGTCTGTGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-681s1c1
Sequence:CCGGCCAACAGTTCTTGGAGGCATACTCGAGTATGCCTCCAAGAACTGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136845    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178516.2-3288s1c1
Sequence:CCGGCCTGATGGAAAGAGTCCAGTACTCGAGTACTGGACTCTTTCCATCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178516.2-1315s1c1
Sequence:CCGGCTTCTGACCTTGGAGAACATTCTCGAGAATGTTCTCCAAGGTCAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178516.2-664s1c1
Sequence:CCGGCAGACTCTGATTGATGGCCAACTCGAGTTGGCCATCAATCAGAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1811s21c1
Sequence:CCGGGAGTTGCAGAGGAGGATCTACCTCGAGGTAGATCCTCCTCTGCAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1169s21c1
Sequence:CCGGCACACGCTGCATAGTGGTTTGCTCGAGCAAACCACTATGCAGCGTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429805    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1144s21c1
Sequence:CCGGGTACAACGTGGTCCAGCTATGCTCGAGCATAGCTGGACCACGTTGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-1688s21c1
Sequence:CCGGCATTACGTGCCCTACCTACTGCTCGAGCAGTAGGTAGGGCACGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178516.3-2463s21c1
Sequence:CCGGCCCTGCTGCTCGCAGAATAAACTCGAGTTTATTCTGCGAGCAGCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)