EMAIL THIS PAGE TO A FRIEND

EXOC3L2

exocyst complex component 3-like 2

62 Gene Product Result for
Synonyms: XTP7
UniProtKB ID: Q2M3D2, Q8N9W2, Q96GV2
Gene ID:
Mouse(74463) exocyst complex component 3-like 2
Rat(686809) exocyst complex component 3-like 2
cow(539328) exocyst complex component 3-like 2
domestic cat(101084756) exocyst complex component 3-like 2
dog(484450) exocyst complex component 3-like 2
domestic guinea pig(100720769) exocyst complex component 3-like 2
naked mole-rat(101725553) exocyst complex component 3-like 2
sheep(101115304) exocyst complex component 3-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138568 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138568 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138568 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU102941 MISSION® esiRNA esiRNA human AC106712.5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138568 Rosetta Predictions human pricing
XM_001075804 Rosetta Predictions rat pricing
NM_028954 Rosetta Predictions mouse pricing
XM_001471750 Rosetta Predictions mouse pricing
XM_001471751 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138568 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034540 predicted 350
2 SASI_Hs02_00363710 predicted 382
3 SASI_Hs01_00034541 predicted 388
4 SASI_Hs01_00034542 predicted 340
5 SASI_Hs01_00034543 predicted 506
6 SASI_Hs01_00034544 predicted 394
7 SASI_Hs01_00034545 predicted 942
8 SASI_Hs01_00034547 predicted 373
9 SASI_Hs01_00034548 predicted 379
10 SASI_Hs01_00034549 predicted 385
11 SASI_Hs01_00034546 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00351102 predicted 2377
2 SASI_Rn02_00351103 predicted 297
3 SASI_Rn02_00351104 predicted 2658
4 SASI_Rn02_00351105 predicted 2337
5 SASI_Rn02_00351106 predicted 2838
6 SASI_Rn02_00351107 predicted 1774
7 SASI_Rn02_00351108 predicted 2825
8 SASI_Rn02_00351109 predicted 1488
9 SASI_Rn02_00351110 predicted 1298
10 SASI_Rn02_00351111 predicted 2648
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186055 predicted 705
2 SASI_Mm01_00186056 predicted 765
3 SASI_Mm01_00186057 predicted 1258
4 SASI_Mm01_00186058 predicted 319
5 SASI_Mm01_00186059 predicted 659
6 SASI_Mm01_00186060 predicted 1266
7 SASI_Mm01_00186061 predicted 280
8 SASI_Mm01_00186062 predicted 392
9 SASI_Mm01_00186063 predicted 482
10 SASI_Mm01_00186064 predicted 1260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001471750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00357600 predicted 1170
2 SASI_Mm02_00357601 predicted 1014
3 SASI_Mm02_00357602 predicted 1157
4 SASI_Mm02_00357603 predicted 698
5 SASI_Mm02_00357604 predicted 755
6 SASI_Mm02_00357605 predicted 1255
7 SASI_Mm02_00357606 predicted 1145
8 SASI_Mm02_00357607 predicted 310
9 SASI_Mm02_00357608 predicted 655
10 SASI_Mm02_00357609 predicted 1256
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001471751 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00357610 predicted 1171
2 SASI_Mm02_00357611 predicted 1010
3 SASI_Mm02_00357612 predicted 1162
4 SASI_Mm02_00357613 predicted 695
5 SASI_Mm02_00357614 predicted 762
6 SASI_Mm02_00357615 predicted 1248
7 SASI_Mm02_00357616 predicted 1144
8 SASI_Mm02_00357617 predicted 309
9 SASI_Mm02_00357618 predicted 656
10 SASI_Mm02_00357619 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138568
EXOC3L2 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-681s21c1
Sequence:CCGGAGAATGCAGGACGAGCCTTACCTCGAGGTAAGGCTCGTCCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-1109s21c1
Sequence:CCGGCCGTGCCTTCTTTGCAGACATCTCGAGATGTCTGCAAAGAAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-110s21c1
Sequence:CCGGTGAATGCGTCACAGATGTTAACTCGAGTTAACATCTGTGACGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-384s21c1
Sequence:CCGGATGCTACCTGACACCTATATCCTCGAGGATATAGGTGTCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138568.2-1376s21c1
Sequence:CCGGGGATAGAAAGACCCTTAGATGCTCGAGCATCTAAGGGTCTTTCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-108s1c1
Sequence:CCGGGATGAATGCGTCACAGATGTTCTCGAGAACATCTGTGACGCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-381s1c1
Sequence:CCGGGAGATGCTACCTGACACCTATCTCGAGATAGGTGTCAGGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-383s1c1
Sequence:CCGGGATGCTACCTGACACCTATATCTCGAGATATAGGTGTCAGGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138568
EXOC3L2 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-681s21c1
Sequence:CCGGAGAATGCAGGACGAGCCTTACCTCGAGGTAAGGCTCGTCCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-1109s21c1
Sequence:CCGGCCGTGCCTTCTTTGCAGACATCTCGAGATGTCTGCAAAGAAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-110s21c1
Sequence:CCGGTGAATGCGTCACAGATGTTAACTCGAGTTAACATCTGTGACGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-384s21c1
Sequence:CCGGATGCTACCTGACACCTATATCCTCGAGGATATAGGTGTCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138568.2-1376s21c1
Sequence:CCGGGGATAGAAAGACCCTTAGATGCTCGAGCATCTAAGGGTCTTTCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-108s1c1
Sequence:CCGGGATGAATGCGTCACAGATGTTCTCGAGAACATCTGTGACGCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-381s1c1
Sequence:CCGGGAGATGCTACCTGACACCTATCTCGAGATAGGTGTCAGGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-383s1c1
Sequence:CCGGGATGCTACCTGACACCTATATCTCGAGATATAGGTGTCAGGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138568
EXOC3L2 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-681s21c1
Sequence:CCGGAGAATGCAGGACGAGCCTTACCTCGAGGTAAGGCTCGTCCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-1109s21c1
Sequence:CCGGCCGTGCCTTCTTTGCAGACATCTCGAGATGTCTGCAAAGAAGGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-110s21c1
Sequence:CCGGTGAATGCGTCACAGATGTTAACTCGAGTTAACATCTGTGACGCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138568.2-384s21c1
Sequence:CCGGATGCTACCTGACACCTATATCCTCGAGGATATAGGTGTCAGGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138568.2-1376s21c1
Sequence:CCGGGGATAGAAAGACCCTTAGATGCTCGAGCATCTAAGGGTCTTTCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168373    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-108s1c1
Sequence:CCGGGATGAATGCGTCACAGATGTTCTCGAGAACATCTGTGACGCATTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-381s1c1
Sequence:CCGGGAGATGCTACCTGACACCTATCTCGAGATAGGTGTCAGGTAGCATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138568.2-383s1c1
Sequence:CCGGGATGCTACCTGACACCTATATCTCGAGATATAGGTGTCAGGTAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028954
EXOC3L2 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028954.1-988s1c1
Sequence:CCGGCCAACGTATTAAGGAATGGTACTCGAGTACCATTCCTTAATACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-762s1c1
Sequence:CCGGTCTGGGATAGGAGGTTCCTTACTCGAGTAAGGAACCTCCTATCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-281s1c1
Sequence:CCGGCAGGCTTATTGGCTTGACCAACTCGAGTTGGTCAAGCCAATAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-313s1c1
Sequence:CCGGCTTGGCAGAGATCCTACAGTTCTCGAGAACTGTAGGATCTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-476s1c1
Sequence:CCGGCGGGACCTGGAACTATCTGAACTCGAGTTCAGATAGTTCCAGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028954
EXOC3L2 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028954.1-988s1c1
Sequence:CCGGCCAACGTATTAAGGAATGGTACTCGAGTACCATTCCTTAATACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-762s1c1
Sequence:CCGGTCTGGGATAGGAGGTTCCTTACTCGAGTAAGGAACCTCCTATCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-281s1c1
Sequence:CCGGCAGGCTTATTGGCTTGACCAACTCGAGTTGGTCAAGCCAATAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-313s1c1
Sequence:CCGGCTTGGCAGAGATCCTACAGTTCTCGAGAACTGTAGGATCTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-476s1c1
Sequence:CCGGCGGGACCTGGAACTATCTGAACTCGAGTTCAGATAGTTCCAGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028954
EXOC3L2 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093464    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028954.1-988s1c1
Sequence:CCGGCCAACGTATTAAGGAATGGTACTCGAGTACCATTCCTTAATACGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-762s1c1
Sequence:CCGGTCTGGGATAGGAGGTTCCTTACTCGAGTAAGGAACCTCCTATCCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-281s1c1
Sequence:CCGGCAGGCTTATTGGCTTGACCAACTCGAGTTGGTCAAGCCAATAAGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-313s1c1
Sequence:CCGGCTTGGCAGAGATCCTACAGTTCTCGAGAACTGTAGGATCTCTGCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028954.1-476s1c1
Sequence:CCGGCGGGACCTGGAACTATCTGAACTCGAGTTCAGATAGTTCCAGGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks