EMAIL THIS PAGE TO A FRIEND

EXOC3L4

exocyst complex component 3-like 4

70 Gene Product Result for
Synonyms: C14orf73
UniProtKB ID: Q17RC7, Q14CR2
Gene ID:
Mouse(74190) exocyst complex component 3-like 4
Rat(299338) exocyst complex component 3-like 4
Zebrafish(563246) exocyst complex component 3-like 4
chicken(423476) exocyst complex component 3-like 4
cow(526547) exocyst complex component 3-like 4
Horse(100058968) exocyst complex component 3-like 4
domestic cat(101084634) exocyst complex component 3-like 4
dog(100686589) exocyst complex component 3-like 4
naked mole-rat(101715976) exocyst complex component 3-like 4
domestic guinea pig(100721668) exocyst complex component 3-like 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA043661 Anti-EXOC3L4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001077594 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001077594 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001077594 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077594 Rosetta Predictions human pricing
XM_040910 Rosetta Predictions human pricing
NM_001106759 Rosetta Predictions rat pricing
NM_028807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077594 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312984 predicted 1338
2 SASI_Hs02_00312985 predicted 2035
3 SASI_Hs02_00312986 predicted 1443
4 SASI_Hs02_00312987 predicted 1949
5 SASI_Hs02_00312988 predicted 487
6 SASI_Hs02_00312989 predicted 440
7 SASI_Hs02_00312990 predicted 2219
8 SASI_Hs02_00312991 predicted 1798
9 SASI_Hs02_00312992 predicted 1876
10 SASI_Hs02_00312993 predicted 264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_040910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00262933 predicted 1290
2 SASI_Hs01_00262934 predicted 1989
3 SASI_Hs01_00262935 predicted 1391
4 SASI_Hs01_00262936 predicted 443
5 SASI_Hs01_00262937 predicted 396
6 SASI_Hs01_00262938 predicted 2179
7 SASI_Hs01_00262939 predicted 1744
8 SASI_Hs01_00262940 predicted 1824
9 SASI_Hs01_00262941 predicted 211
10 SASI_Hs01_00262942 predicted 1567
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222118 predicted 2481
2 SASI_Rn02_00222119 predicted 825
3 SASI_Rn02_00222120 predicted 2318
4 SASI_Rn02_00222121 predicted 2280
5 SASI_Rn02_00222122 predicted 1841
6 SASI_Rn02_00222123 predicted 1873
7 SASI_Rn02_00222124 predicted 1858
8 SASI_Rn02_00222125 predicted 1435
9 SASI_Rn02_00222126 predicted 1834
10 SASI_Rn02_00222127 predicted 2079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026415 predicted 2013
2 SASI_Mm01_00026416 predicted 2217
3 SASI_Mm01_00026417 predicted 2088
4 SASI_Mm01_00026418 predicted 2078
5 SASI_Mm01_00026419 predicted 964
6 SASI_Mm01_00026420 predicted 872
7 SASI_Mm02_00334421 predicted 2461
8 SASI_Mm01_00026422 predicted 2566
9 SASI_Mm02_00334422 predicted 2424
10 SASI_Mm01_00026423 predicted 2228
11 SASI_Mm01_00026421 predicted 2304
12 SASI_Mm01_00026424 predicted 1288
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028807
EXOC3L4 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028807.2-2604s1c1
Sequence:CCGGGATGAGGCATTCCGGGCATTTCTCGAGAAATGCCCGGAATGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-450s1c1
Sequence:CCGGCCTGAGAACTTCAACCCACAACTCGAGTTGTGGGTTGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2209s1c1
Sequence:CCGGCGGCACCTGGAAACACTTATACTCGAGTATAAGTGTTTCCAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-1855s1c1
Sequence:CCGGCCTCTATTTAAGGTGCTATATCTCGAGATATAGCACCTTAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2412s1c1
Sequence:CCGGCGTGCTAATCACCTGCATCTACTCGAGTAGATGCAGGTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028807
EXOC3L4 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028807.2-2604s1c1
Sequence:CCGGGATGAGGCATTCCGGGCATTTCTCGAGAAATGCCCGGAATGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-450s1c1
Sequence:CCGGCCTGAGAACTTCAACCCACAACTCGAGTTGTGGGTTGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2209s1c1
Sequence:CCGGCGGCACCTGGAAACACTTATACTCGAGTATAAGTGTTTCCAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-1855s1c1
Sequence:CCGGCCTCTATTTAAGGTGCTATATCTCGAGATATAGCACCTTAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2412s1c1
Sequence:CCGGCGTGCTAATCACCTGCATCTACTCGAGTAGATGCAGGTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028807
EXOC3L4 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028807.2-2604s1c1
Sequence:CCGGGATGAGGCATTCCGGGCATTTCTCGAGAAATGCCCGGAATGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111538    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-450s1c1
Sequence:CCGGCCTGAGAACTTCAACCCACAACTCGAGTTGTGGGTTGAAGTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2209s1c1
Sequence:CCGGCGGCACCTGGAAACACTTATACTCGAGTATAAGTGTTTCCAGGTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-1855s1c1
Sequence:CCGGCCTCTATTTAAGGTGCTATATCTCGAGATATAGCACCTTAAATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028807.2-2412s1c1
Sequence:CCGGCGTGCTAATCACCTGCATCTACTCGAGTAGATGCAGGTGATTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001077594
EXOC3L4 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 3-like 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000283743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-613s21c1
Sequence:CCGGTATGGACGTGTGCCTGCTTTACTCGAGTAAAGCAGGCACACGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077594.1-2348s21c1
Sequence:CCGGGACACTGCAGTTAGGGAATTTCTCGAGAAATTCCCTAACTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-441s21c1
Sequence:CCGGCAGCGTCTGAGGAACTGAAACCTCGAGGTTTCAGTTCCTCAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-2228s21c1
Sequence:CCGGCTGATCACCTGCGTCTAGTTCCTCGAGGAACTAGACGCAGGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001077594
EXOC3L4 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 3-like 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000283743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-613s21c1
Sequence:CCGGTATGGACGTGTGCCTGCTTTACTCGAGTAAAGCAGGCACACGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077594.1-2348s21c1
Sequence:CCGGGACACTGCAGTTAGGGAATTTCTCGAGAAATTCCCTAACTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-441s21c1
Sequence:CCGGCAGCGTCTGAGGAACTGAAACCTCGAGGTTTCAGTTCCTCAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-2228s21c1
Sequence:CCGGCTGATCACCTGCGTCTAGTTCCTCGAGGAACTAGACGCAGGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001077594
EXOC3L4 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 3-like 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000283743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-613s21c1
Sequence:CCGGTATGGACGTGTGCCTGCTTTACTCGAGTAAAGCAGGCACACGTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001077594.1-2348s21c1
Sequence:CCGGGACACTGCAGTTAGGGAATTTCTCGAGAAATTCCCTAACTGCAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-441s21c1
Sequence:CCGGCAGCGTCTGAGGAACTGAAACCTCGAGGTTTCAGTTCCTCAGACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001077594.1-2228s21c1
Sequence:CCGGCTGATCACCTGCGTCTAGTTCCTCGAGGAACTAGACGCAGGTGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks