EMAIL THIS PAGE TO A FRIEND

EXOC4

exocyst complex component 4

121 Gene Product Result for
Synonyms: SEC8 SEC8L1 Sec8p
UniProtKB ID: Q96A65, E9PED2, Q541U8, Q9C0G4, Q9H9K0, Q9P102
Gene ID:
Human(60412) Summary: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Mouse(20336) exocyst complex component 4
Rat(116654) exocyst complex component 4
domestic guinea pig(100718848) exocyst complex component 4
naked mole-rat(101722243) exocyst complex component 4
sheep(101107440) exocyst complex component 4
Zebrafish(559866) exocyst complex component 4
chicken(416700) exocyst complex component 4
dog(482250) exocyst complex component 4
Horse(100065209) exocyst complex component 4
cow(537690) exocyst complex component 4
domestic cat(101092672) exocyst complex component 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021807 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037126 Rosetta Predictions human pricing
NM_021807 Rosetta Predictions human pricing
XM_001063828 Rosetta Predictions rat pricing
XM_001063871 Rosetta Predictions rat pricing
XM_342655 Rosetta Predictions rat pricing
NM_009148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154511 predicted 869
2 SASI_Hs01_00154512 predicted 750
3 SASI_Hs01_00154513 predicted 910
4 SASI_Hs02_00308211 predicted 689
5 SASI_Hs01_00154514 predicted 910
6 SASI_Hs01_00154517 predicted 203
7 SASI_Hs01_00154518 predicted 564
8 SASI_Hs01_00154519 predicted 629
9 SASI_Hs01_00154520 predicted 582
10 SASI_Hs02_00308212 predicted 272
11 SASI_Hs01_00154515 predicted 377
12 SASI_Hs01_00154516 predicted 1330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355109 predicted 874
2 SASI_Hs02_00355110 predicted 751
3 SASI_Hs02_00355111 predicted 902
4 SASI_Hs02_00355112 predicted 695
5 SASI_Hs02_00355113 predicted 914
6 SASI_Hs02_00355114 predicted 205
7 SASI_Hs02_00355115 predicted 564
8 SASI_Hs02_00355116 predicted 630
9 SASI_Hs02_00355117 predicted 589
10 SASI_Hs02_00355118 predicted 275
11 SASI_Hs01_00167438 predicted 1522
12 SASI_Hs01_00167439 predicted 1463
13 SASI_Hs01_00167440 predicted 1590
14 SASI_Hs01_00167441 predicted 1982
15 SASI_Hs01_00167442 predicted 1508
16 SASI_Hs01_00167443 predicted 2203
17 SASI_Hs01_00167444 predicted 2435
18 SASI_Hs01_00167445 predicted 2225
19 SASI_Hs01_00167446 predicted 2327
20 SASI_Hs01_00167447 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063828 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308417 predicted 308
2 SASI_Rn02_00308418 predicted 771
3 SASI_Rn02_00308419 predicted 2634
4 SASI_Rn02_00308420 predicted 1619
5 SASI_Rn02_00308421 predicted 2142
6 SASI_Rn02_00308422 predicted 2037
7 SASI_Rn02_00308423 predicted 291
8 SASI_Rn02_00308424 predicted 1951
9 SASI_Rn02_00308425 predicted 1759
10 SASI_Rn02_00308426 predicted 1575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00308549 predicted 307
2 SASI_Rn02_00308550 predicted 766
3 SASI_Rn02_00308551 predicted 1096
4 SASI_Rn02_00308552 predicted 935
5 SASI_Rn02_00308553 predicted 2633
6 SASI_Rn02_00308554 predicted 1625
7 SASI_Rn02_00308555 predicted 995
8 SASI_Rn02_00308556 predicted 2034
9 SASI_Rn02_00308557 predicted 283
10 SASI_Rn02_00308558 predicted 1763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342655 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394620 predicted 991
2 SASI_Rn02_00394621 predicted 310
3 SASI_Rn02_00394622 predicted 763
4 SASI_Rn02_00394623 predicted 1097
5 SASI_Rn02_00394624 predicted 934
6 SASI_Rn02_00394625 predicted 2627
7 SASI_Rn02_00394626 predicted 1625
8 SASI_Rn02_00394627 predicted 283
9 SASI_Rn02_00394628 predicted 983
10 SASI_Rn02_00394629 predicted 1756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112612 predicted 3020
2 SASI_Mm01_00112613 predicted 923
3 SASI_Mm01_00112616 predicted 215
4 SASI_Mm01_00112617 predicted 223
5 SASI_Mm01_00112618 predicted 2564
6 SASI_Mm01_00112619 predicted 597
7 SASI_Mm01_00112620 predicted 1561
8 SASI_Mm02_00315463 predicted 726
9 SASI_Mm01_00112621 predicted 921
10 SASI_Mm02_00315464 predicted 376
11 SASI_Mm01_00112614 predicted 872
12 SASI_Mm01_00112615 predicted 1644
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009148
VALIDATED
EXOC4 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-709s21c1
Sequence:CCGGATCCCTACTCCACGCAAATTCCTCGAGGAATTTGCGTGGAGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009148.3-3040s21c1
Sequence:CCGGGTGGGTAGGCGGTGGATTATTCTCGAGAATAATCCACCGCCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-231s21c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-348s21c1
Sequence:CCGGGATTGAAGGAATCGAGCATAACTCGAGTTATGCTCGATTCCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-247s21c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1605s1c1
Sequence:CCGGCGAGAGTTTCTTACCGTGTATCTCGAGATACACGGTAAGAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-257s1c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1985s1c1
Sequence:CCGGGCTGCCAAACTGGACTAACATCTCGAGATGTTAGTCCAGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-273s1c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1510s1c1
Sequence:CCGGCCAGAAATATTACCGTCATATCTCGAGATATGACGGTAATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009148
VALIDATED
EXOC4 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-709s21c1
Sequence:CCGGATCCCTACTCCACGCAAATTCCTCGAGGAATTTGCGTGGAGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009148.3-3040s21c1
Sequence:CCGGGTGGGTAGGCGGTGGATTATTCTCGAGAATAATCCACCGCCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-231s21c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-348s21c1
Sequence:CCGGGATTGAAGGAATCGAGCATAACTCGAGTTATGCTCGATTCCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-247s21c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1605s1c1
Sequence:CCGGCGAGAGTTTCTTACCGTGTATCTCGAGATACACGGTAAGAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-257s1c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1985s1c1
Sequence:CCGGGCTGCCAAACTGGACTAACATCTCGAGATGTTAGTCCAGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-273s1c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1510s1c1
Sequence:CCGGCCAGAAATATTACCGTCATATCTCGAGATATGACGGTAATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009148
VALIDATED
EXOC4 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-709s21c1
Sequence:CCGGATCCCTACTCCACGCAAATTCCTCGAGGAATTTGCGTGGAGTAGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294721    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009148.3-3040s21c1
Sequence:CCGGGTGGGTAGGCGGTGGATTATTCTCGAGAATAATCCACCGCCTACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-231s21c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-348s21c1
Sequence:CCGGGATTGAAGGAATCGAGCATAACTCGAGTTATGCTCGATTCCTTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009148.3-247s21c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1605s1c1
Sequence:CCGGCGAGAGTTTCTTACCGTGTATCTCGAGATACACGGTAAGAAACTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-257s1c1
Sequence:CCGGCCAGAGTATCACAGAACGCATCTCGAGATGCGTTCTGTGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1985s1c1
Sequence:CCGGGCTGCCAAACTGGACTAACATCTCGAGATGTTAGTCCAGTTTGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-273s1c1
Sequence:CCGGCGCATCACTAACTCGAGGAATCTCGAGATTCCTCGAGTTAGTGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009148.1-1510s1c1
Sequence:CCGGCCAGAAATATTACCGTCATATCTCGAGATATGACGGTAATATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021807
VALIDATED
EXOC4 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2582s1c1
Sequence:CCGGCCTCATTAATGGTGCCCAGTACTCGAGTACTGGGCACCATTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-905s1c1
Sequence:CCGGCCCAGAAACAGTTAAGGCAATCTCGAGATTGCCTTAACTGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021807.2-401s1c1
Sequence:CCGGCCTGAACTTGTTGGATGAAATCTCGAGATTTCATCCAACAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2933s1c1
Sequence:CCGGCAAGAAGATAACTACCGTTTACTCGAGTAAACGGTAGTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3722s1c1
Sequence:CCGGCCCTAATTTCTGAGAGAATAACTCGAGTTATTCTCTCAGAAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3652s1c1
Sequence:CCGGGCCAGACAATTAGACAACTATCTCGAGATAGTTGTCTAATTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021807
VALIDATED
EXOC4 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2582s1c1
Sequence:CCGGCCTCATTAATGGTGCCCAGTACTCGAGTACTGGGCACCATTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-905s1c1
Sequence:CCGGCCCAGAAACAGTTAAGGCAATCTCGAGATTGCCTTAACTGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021807.2-401s1c1
Sequence:CCGGCCTGAACTTGTTGGATGAAATCTCGAGATTTCATCCAACAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2933s1c1
Sequence:CCGGCAAGAAGATAACTACCGTTTACTCGAGTAAACGGTAGTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3722s1c1
Sequence:CCGGCCCTAATTTCTGAGAGAATAACTCGAGTTATTCTCTCAGAAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3652s1c1
Sequence:CCGGGCCAGACAATTAGACAACTATCTCGAGATAGTTGTCTAATTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021807
VALIDATED
EXOC4 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164165    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2582s1c1
Sequence:CCGGCCTCATTAATGGTGCCCAGTACTCGAGTACTGGGCACCATTAATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160821    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-905s1c1
Sequence:CCGGCCCAGAAACAGTTAAGGCAATCTCGAGATTGCCTTAACTGTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_021807.2-401s1c1
Sequence:CCGGCCTGAACTTGTTGGATGAAATCTCGAGATTTCATCCAACAAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021807.2-2933s1c1
Sequence:CCGGCAAGAAGATAACTACCGTTTACTCGAGTAAACGGTAGTTATCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202603    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3722s1c1
Sequence:CCGGCCCTAATTTCTGAGAGAATAACTCGAGTTATTCTCTCAGAAATTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186909    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021807.2-3652s1c1
Sequence:CCGGGCCAGACAATTAGACAACTATCTCGAGATAGTTGTCTAATTGTCTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks