EMAIL THIS PAGE TO A FRIEND

EXOC5

exocyst complex component 5

Synonyms: HSEC10 PRO1912 SEC10 SEC10L1 SEC10P
UniProtKB ID: O00471, B2R6C5
Gene ID:
Human(10640) Summary: The protein encoded by this gene is a component of the exocyst complex, a multiple protein complex essential for targeting exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and functions of exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. The complex is also essential for the biogenesis of epithelial cell surface polarity. [provided by RefSeq, Jul 2008]
Mouse(105504) exocyst complex component 5
Rat(60627) exocyst complex component 5
Zebrafish(559010) exocyst complex component 5
chicken(423549) exocyst complex component 5
cow(531907) exocyst complex component 5
domestic cat(101096900) exocyst complex component 5
dog(490710) exocyst complex component 5
sheep(101121014) exocyst complex component 5
naked mole-rat(101698248) exocyst complex component 5
domestic guinea pig(100732302) exocyst complex component 5
174 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_207214 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207214 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207214 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006544 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006544 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006544 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006544 Rosetta Predictions human pricing
NM_022204 Rosetta Predictions rat pricing
NM_207214 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006544 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167125 predicted 1217
2 SASI_Hs01_00167127 predicted 922
3 SASI_Hs01_00167128 predicted 1410
4 SASI_Hs02_00341806 predicted 1416
5 SASI_Hs01_00167129 predicted 845
6 SASI_Hs01_00167132 predicted 1253
7 SASI_Hs01_00167133 predicted 1163
8 SASI_Hs01_00167134 predicted 1231
9 SASI_Hs02_00341807 predicted 1211
10 SASI_Hs02_00341808 predicted 535
11 SASI_Hs01_00167126 predicted 489
12 SASI_Hs01_00167130 predicted 2470
13 SASI_Hs01_00167131 predicted 2417
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262956 predicted 2158
2 SASI_Rn02_00262957 predicted 403
3 SASI_Rn01_00063266 predicted 1002
4 SASI_Rn01_00063269 predicted 1681
5 SASI_Rn01_00063270 predicted 1461
6 SASI_Rn01_00063271 predicted 1103
7 SASI_Rn01_00063272 predicted 2122
8 SASI_Rn02_00262958 predicted 1594
9 SASI_Rn02_00262959 predicted 1228
10 SASI_Rn01_00063273 predicted 2048
11 SASI_Rn01_00063265 predicted 1414
12 SASI_Rn01_00063267 predicted 1606
13 SASI_Rn01_00063268 predicted 306
14 SASI_Rn01_00063274 predicted 323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207214 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170596 predicted 2438
2 SASI_Mm01_00170597 predicted 1026
3 SASI_Mm01_00170598 predicted 2589
4 SASI_Mm01_00170599 predicted 2098
5 SASI_Mm01_00170600 predicted 1332
6 SASI_Mm01_00170601 predicted 1381
7 SASI_Mm01_00170602 predicted 2317
8 SASI_Mm01_00170603 predicted 1970
9 SASI_Mm01_00170604 predicted 1740
10 SASI_Mm01_00170605 predicted 901
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207214
VALIDATED
EXOC5 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-2416s1c1
Sequence:CCGGGCAGCCATACTTACCTGGAATCTCGAGATTCCAGGTAAGTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-2006s1c1
Sequence:CCGGCGGCTTATTTATGAACATCTTCTCGAGAAGATGTTCATAAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-1139s1c1
Sequence:CCGGGAGTTTAACTTAGGTACTGATCTCGAGATCAGTACCTAAGTTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-1311s1c1
Sequence:CCGGGCACAGGAGGTATTCAAGATTCTCGAGAATCTTGAATACCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-681s1c1
Sequence:CCGGCCCAGGAGTTACCTTTCGATACTCGAGTATCGAAAGGTAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207214
VALIDATED
EXOC5 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-2416s1c1
Sequence:CCGGGCAGCCATACTTACCTGGAATCTCGAGATTCCAGGTAAGTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-2006s1c1
Sequence:CCGGCGGCTTATTTATGAACATCTTCTCGAGAAGATGTTCATAAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-1139s1c1
Sequence:CCGGGAGTTTAACTTAGGTACTGATCTCGAGATCAGTACCTAAGTTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-1311s1c1
Sequence:CCGGGCACAGGAGGTATTCAAGATTCTCGAGAATCTTGAATACCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-681s1c1
Sequence:CCGGCCCAGGAGTTACCTTTCGATACTCGAGTATCGAAAGGTAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207214
VALIDATED
EXOC5 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093544    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-2416s1c1
Sequence:CCGGGCAGCCATACTTACCTGGAATCTCGAGATTCCAGGTAAGTATGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-2006s1c1
Sequence:CCGGCGGCTTATTTATGAACATCTTCTCGAGAAGATGTTCATAAATAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-1139s1c1
Sequence:CCGGGAGTTTAACTTAGGTACTGATCTCGAGATCAGTACCTAAGTTAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207214.1-1311s1c1
Sequence:CCGGGCACAGGAGGTATTCAAGATTCTCGAGAATCTTGAATACCTCCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_207214.1-681s1c1
Sequence:CCGGCCCAGGAGTTACCTTTCGATACTCGAGTATCGAAAGGTAACTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006544
VALIDATED
EXOC5 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006544.2-755s1c1
Sequence:CCGGGCACCTAATTGCCCAAGAGTTCTCGAGAACTCTTGGGCAATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2091s1c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-576s1c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2149s1c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-838s1c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006544.3-570s21c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2085s21c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-832s21c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2143s21c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1423s21c1
Sequence:CCGGTTAGACAGCGTACCAACTTACCTCGAGGTAAGTTGGTACGCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1206s21c1
Sequence:CCGGAGCAAGCTGATGGAGTTTAATCTCGAGATTAAACTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006544
VALIDATED
EXOC5 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006544.2-755s1c1
Sequence:CCGGGCACCTAATTGCCCAAGAGTTCTCGAGAACTCTTGGGCAATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2091s1c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-576s1c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2149s1c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-838s1c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006544.3-570s21c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2085s21c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-832s21c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2143s21c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1423s21c1
Sequence:CCGGTTAGACAGCGTACCAACTTACCTCGAGGTAAGTTGGTACGCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1206s21c1
Sequence:CCGGAGCAAGCTGATGGAGTTTAATCTCGAGATTAAACTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006544
VALIDATED
EXOC5 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006544.2-755s1c1
Sequence:CCGGGCACCTAATTGCCCAAGAGTTCTCGAGAACTCTTGGGCAATTAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2091s1c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061965    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-576s1c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-2149s1c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061964    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006544.2-838s1c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300050    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006544.3-570s21c1
Sequence:CCGGGCAACTAAAGTCTGTCACCTTCTCGAGAAGGTGACAGACTTTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2085s21c1
Sequence:CCGGCGACTTATCTATGAGCATCTTCTCGAGAAGATGCTCATAGATAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-832s21c1
Sequence:CCGGGCCAGCTGATTCAGGAGTTTACTCGAGTAAACTCCTGAATCAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-2143s21c1
Sequence:CCGGCCATTTGTGATGTAGCCGAATCTCGAGATTCGGCTACATCACAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1423s21c1
Sequence:CCGGTTAGACAGCGTACCAACTTACCTCGAGGTAAGTTGGTACGCTGTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_006544.3-1206s21c1
Sequence:CCGGAGCAAGCTGATGGAGTTTAATCTCGAGATTAAACTCCATCAGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks