EMAIL THIS PAGE TO A FRIEND

EXOC6B

exocyst complex component 6B

217 Gene Product Result for
Synonyms: SEC15B SEC15L2
UniProtKB ID: Q9Y2D4, B8ZZY3
Gene ID:
Human(23233) Summary: In yeast and rat, Sec15 is part of a multiprotein complex that is required for targeted exocytosis.[supplied by OMIM, Apr 2004]
Mouse(75914) exocyst complex component 6B
Rat(500233) exocyst complex component 6B
sheep(101111176) exocyst complex component 6B
Domestic Rabbit(100340217) exocyst complex component 6B
naked mole-rat(101712855) exocyst complex component 6B
domestic guinea pig(100719686) exocyst complex component 6B
Zebrafish(767763) exocyst complex component 6B
cow(616280) exocyst complex component 6B
Horse(100059535) exocyst complex component 6B
domestic cat(101100959) exocyst complex component 6B
dog(483119) exocyst complex component 6B
chicken(422955) exocyst complex component 6B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015189 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015189 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015189 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001479977 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001479977 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001479977 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063561 MISSION® esiRNA esiRNA targeting mouse Exoc6b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015189 Rosetta Predictions human pricing
XM_039570 Rosetta Predictions human pricing
NM_001109246 Rosetta Predictions rat pricing
XM_575583 Rosetta Predictions rat pricing
XM_001479977 Rosetta Predictions mouse pricing
XM_355790 Rosetta Predictions mouse pricing
XM_889280 Rosetta Predictions mouse pricing
XM_898417 Rosetta Predictions mouse pricing
XM_898421 Rosetta Predictions mouse pricing
XM_898430 Rosetta Predictions mouse pricing
XM_898443 Rosetta Predictions mouse pricing
XM_913967 Rosetta Predictions mouse pricing
XM_922979 Rosetta Predictions mouse pricing
XM_922986 Rosetta Predictions mouse pricing
XM_922994 Rosetta Predictions mouse pricing
XM_978347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015189 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00347247 predicted 275
2 SASI_Hs02_00347248 predicted 2083
3 SASI_Hs02_00347249 predicted 2240
4 SASI_Hs02_00347250 predicted 649
5 SASI_Hs02_00347251 predicted 1443
6 SASI_Hs02_00347252 predicted 2067
7 SASI_Hs02_00347253 predicted 1788
8 SASI_Hs02_00347254 predicted 302
9 SASI_Hs02_00347255 predicted 2366
10 SASI_Hs02_00347256 predicted 1116
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_039570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00287580 predicted 369
2 SASI_Hs01_00287581 predicted 955
3 SASI_Hs01_00287582 predicted 2491
4 SASI_Hs01_00287583 predicted 1468
5 SASI_Hs01_00287584 predicted 747
6 SASI_Hs01_00287585 predicted 1542
7 SASI_Hs01_00287586 predicted 1883
8 SASI_Hs01_00287587 predicted 405
9 SASI_Hs01_00287588 predicted 2466
10 SASI_Hs01_00287589 predicted 1217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109246 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246524 predicted 2173
2 SASI_Rn02_00246525 predicted 2257
3 SASI_Rn02_00246526 predicted 1098
4 SASI_Rn02_00246527 predicted 1723
5 SASI_Rn02_00246528 predicted 387
6 SASI_Rn02_00246529 predicted 1423
7 SASI_Rn02_00246530 predicted 266
8 SASI_Rn02_00246531 predicted 1565
9 SASI_Rn02_00246532 predicted 1438
10 SASI_Rn02_00246533 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149067 predicted 1328
2 SASI_Rn01_00149068 predicted 1125
3 SASI_Rn01_00149069 predicted 1876
4 SASI_Rn01_00149070 predicted 1533
5 SASI_Rn01_00149071 predicted 1660
6 SASI_Rn01_00149072 predicted 1122
7 SASI_Rn01_00149073 predicted 1790
8 SASI_Rn01_00149074 predicted 1656
9 SASI_Rn01_00149075 predicted 1205
10 SASI_Rn01_00149076 predicted 1884
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001479977 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414108 predicted 1262
2 SASI_Mm02_00414109 predicted 462
3 SASI_Mm02_00414110 predicted 2608
4 SASI_Mm02_00414111 predicted 1852
5 SASI_Mm02_00414112 predicted 1498
6 SASI_Mm02_00414113 predicted 2273
7 SASI_Mm02_00414114 predicted 2035
8 SASI_Mm02_00414115 predicted 1106
9 SASI_Mm02_00414116 predicted 1738
10 SASI_Mm02_00414117 predicted 1438
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355790 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216178 predicted 1285
2 SASI_Mm01_00216179 predicted 460
3 SASI_Mm01_00216180 predicted 2641
4 SASI_Mm02_00425849 predicted 1879
5 SASI_Mm01_00216181 predicted 1520
6 SASI_Mm02_00425850 predicted 2050
7 SASI_Mm01_00216183 predicted 1127
8 SASI_Mm01_00216184 predicted 1759
9 SASI_Mm01_00216186 predicted 1456
10 SASI_Mm02_00425851 predicted 2017
11 SASI_Mm01_00216177 predicted 812
12 SASI_Mm01_00216182 predicted 2297
13 SASI_Mm01_00216185 predicted 1125
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_889280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254874 predicted 1279
2 SASI_Mm01_00254875 predicted 460
3 SASI_Mm01_00254876 predicted 2626
4 SASI_Mm02_00428773 predicted 1875
5 SASI_Mm01_00254877 predicted 1516
6 SASI_Mm01_00254878 predicted 2295
7 SASI_Mm01_00254879 predicted 1128
8 SASI_Mm01_00254880 predicted 1753
9 SASI_Mm01_00254882 predicted 1451
10 SASI_Mm02_00428774 predicted 2013
11 SASI_Mm01_00254873 predicted 811
12 SASI_Mm01_00254881 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215314 predicted 465
2 SASI_Mm01_00215315 predicted 698
3 SASI_Mm01_00215316 predicted 864
4 SASI_Mm01_00215317 predicted 940
5 SASI_Mm01_00215318 predicted 421
6 SASI_Mm01_00215319 predicted 645
7 SASI_Mm01_00215320 predicted 624
8 SASI_Mm01_00215321 predicted 567
9 SASI_Mm01_00215322 predicted 480
10 SASI_Mm01_00215323 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898421 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00267552 predicted 211
2 SASI_Mm01_00267553 predicted 272
3 SASI_Mm01_00267554 predicted 252
4 SASI_Mm01_00267555 predicted 363
5 SASI_Mm01_00267556 predicted 364
6 SASI_Mm01_00267557 predicted 213
7 SASI_Mm01_00267558 predicted 207
8 SASI_Mm01_00267559 predicted 223
9 SASI_Mm01_00267560 predicted 334
10 SASI_Mm01_00267561 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00268923 predicted 802
2 SASI_Mm01_00268924 predicted 1292
3 SASI_Mm01_00268925 predicted 471
4 SASI_Mm01_00268926 predicted 1528
5 SASI_Mm01_00268927 predicted 2128
6 SASI_Mm01_00268928 predicted 1140
7 SASI_Mm01_00268929 predicted 1767
8 SASI_Mm01_00268930 predicted 1132
9 SASI_Mm01_00268931 predicted 1456
10 SASI_Mm01_00268932 predicted 2026
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227109 predicted 908
2 SASI_Mm01_00227110 predicted 732
3 SASI_Mm01_00227111 predicted 397
4 SASI_Mm01_00227112 predicted 841
5 SASI_Mm01_00227113 predicted 820
6 SASI_Mm01_00227114 predicted 836
7 SASI_Mm01_00227115 predicted 546
8 SASI_Mm01_00227116 predicted 264
9 SASI_Mm01_00227117 predicted 471
10 SASI_Mm01_00227118 predicted 777
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_913967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00438174 predicted 1283
2 SASI_Mm02_00438175 predicted 466
3 SASI_Mm02_00438176 predicted 2620
4 SASI_Mm02_00438177 predicted 1879
5 SASI_Mm02_00438178 predicted 1522
6 SASI_Mm02_00438179 predicted 2293
7 SASI_Mm02_00438180 predicted 1129
8 SASI_Mm02_00438181 predicted 1752
9 SASI_Mm02_00438182 predicted 1452
10 SASI_Mm02_00438183 predicted 2020
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922979 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443572 predicted 1286
2 SASI_Mm02_00443573 predicted 466
3 SASI_Mm02_00443574 predicted 2637
4 SASI_Mm02_00443575 predicted 1875
5 SASI_Mm02_00443576 predicted 1520
6 SASI_Mm02_00443577 predicted 2297
7 SASI_Mm02_00443578 predicted 1131
8 SASI_Mm02_00443579 predicted 1760
9 SASI_Mm02_00443580 predicted 1455
10 SASI_Mm02_00443581 predicted 2014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922986 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443582 predicted 1258
2 SASI_Mm02_00443583 predicted 458
3 SASI_Mm02_00443584 predicted 2600
4 SASI_Mm02_00443585 predicted 1858
5 SASI_Mm02_00443586 predicted 1500
6 SASI_Mm02_00443587 predicted 2275
7 SASI_Mm02_00443588 predicted 1114
8 SASI_Mm02_00443589 predicted 1734
9 SASI_Mm02_00443590 predicted 1439
10 SASI_Mm02_00443591 predicted 2000
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_922994 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443600 predicted 1256
2 SASI_Mm02_00443601 predicted 457
3 SASI_Mm02_00443602 predicted 2591
4 SASI_Mm02_00443603 predicted 1842
5 SASI_Mm02_00443604 predicted 2259
6 SASI_Mm02_00443605 predicted 841
7 SASI_Mm02_00443606 predicted 852
8 SASI_Mm02_00443607 predicted 1101
9 SASI_Mm02_00443608 predicted 1722
10 SASI_Mm02_00443609 predicted 1426
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00285467 predicted 1255
2 SASI_Mm02_00446621 predicted 459
3 SASI_Mm01_00285468 predicted 2590
4 SASI_Mm02_00446622 predicted 1842
5 SASI_Mm02_00446623 predicted 1488
6 SASI_Mm01_00285469 predicted 2263
7 SASI_Mm02_00446624 predicted 2020
8 SASI_Mm01_00285472 predicted 1097
9 SASI_Mm01_00285473 predicted 1729
10 SASI_Mm01_00285475 predicted 1423
11 SASI_Mm01_00285470 predicted 853
12 SASI_Mm01_00285471 predicted 856
13 SASI_Mm01_00285474 predicted 1093
14 SASI_Mm01_00285476 predicted 1998
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015189
VALIDATED
EXOC6B MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 6B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1215s21c1
Sequence:CCGGTACAACCCAGGGCTTAGTAAACTCGAGTTTACTAAGCCCTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-2030s21c1
Sequence:CCGGCCGGAGATTTGGGCAACAAAGCTCGAGCTTTGTTGCCCAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-356s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATAACTCGAGTTATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1703s21c1
Sequence:CCGGTTGATGACATGATTCGGAAATCTCGAGATTTCCGAATCATGTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015189.1-454s21c1
Sequence:CCGGGAGGGAAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015189
VALIDATED
EXOC6B MISSION shRNA shRNA Plasmid DNA
exocyst complex component 6B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1215s21c1
Sequence:CCGGTACAACCCAGGGCTTAGTAAACTCGAGTTTACTAAGCCCTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-2030s21c1
Sequence:CCGGCCGGAGATTTGGGCAACAAAGCTCGAGCTTTGTTGCCCAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-356s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATAACTCGAGTTATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1703s21c1
Sequence:CCGGTTGATGACATGATTCGGAAATCTCGAGATTTCCGAATCATGTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015189.1-454s21c1
Sequence:CCGGGAGGGAAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015189
VALIDATED
EXOC6B MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 6B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1215s21c1
Sequence:CCGGTACAACCCAGGGCTTAGTAAACTCGAGTTTACTAAGCCCTGGGTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-2030s21c1
Sequence:CCGGCCGGAGATTTGGGCAACAAAGCTCGAGCTTTGTTGCCCAAATCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-356s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATAACTCGAGTTATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247578    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_015189.1-1703s21c1
Sequence:CCGGTTGATGACATGATTCGGAAATCTCGAGATTTCCGAATCATGTCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015189.1-454s21c1
Sequence:CCGGGAGGGAAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTTCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001479977
VALIDATED
EXOC6B MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-2775s21c1
Sequence:CCGGATCCAGTGCTCCACGAATTTACTCGAGTAAATTCGTGGAGCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-421s21c1
Sequence:CCGGGAGGGCAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-1060s21c1
Sequence:CCGGGTACTCCAGCCTCCGTCTAATCTCGAGATTAGACGGAGGCTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479977.1-864s21c1
Sequence:CCGGACTCTACAGTAAGTCTAATATCTCGAGATATTAGACTTACTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-323s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATTACTCGAGTAATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001479977
VALIDATED
EXOC6B MISSION shRNA shRNA Plasmid DNA
exocyst complex component 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-2775s21c1
Sequence:CCGGATCCAGTGCTCCACGAATTTACTCGAGTAAATTCGTGGAGCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-421s21c1
Sequence:CCGGGAGGGCAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-1060s21c1
Sequence:CCGGGTACTCCAGCCTCCGTCTAATCTCGAGATTAGACGGAGGCTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479977.1-864s21c1
Sequence:CCGGACTCTACAGTAAGTCTAATATCTCGAGATATTAGACTTACTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-323s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATTACTCGAGTAATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001479977
VALIDATED
EXOC6B MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-2775s21c1
Sequence:CCGGATCCAGTGCTCCACGAATTTACTCGAGTAAATTCGTGGAGCACTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-421s21c1
Sequence:CCGGGAGGGCAAGGAACTGGTAATACTCGAGTATTACCAGTTCCTTGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-1060s21c1
Sequence:CCGGGTACTCCAGCCTCCGTCTAATCTCGAGATTAGACGGAGGCTGGAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001479977.1-864s21c1
Sequence:CCGGACTCTACAGTAAGTCTAATATCTCGAGATATTAGACTTACTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:XM_001479977.1-323s21c1
Sequence:CCGGAGGGCTTTGTGGACTCTATTACTCGAGTAATAGAGTCCACAAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks