EMAIL THIS PAGE TO A FRIEND

EXOC7

exocyst complex component 7

95 Gene Product Result for
Synonyms: 2-5-3p EX070 EXO70 EXOC1 Exo70p YJL085W
Gene ID:
Human(23265) Summary: The protein encoded by this gene is a component of the exocyst complex. The exocyst complex plays a critical role in vesicular trafficking and the secretory pathway by targeting post-Golgi vesicles to the plasma membrane. The encoded protein is required for assembly of the exocyst complex and docking of the complex to the plasma membrane. The encoded protein may also play a role in pre-mRNA splicing through interactions with pre-mRNA-processing factor 19. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Nov 2011]
Mouse(53413) exocyst complex component 7
Rat(64632) exocyst complex component 7
Zebrafish(406723) exocyst complex component 7
chicken(417361) exocyst complex component 7
cow(505568) exocyst complex component 7
Horse(100059108) exocyst complex component 7
domestic cat(101083815) exocyst complex component 7
dog(100682715) exocyst complex component 7
domestic guinea pig(100721838) exocyst complex component 7
naked mole-rat(101707292) exocyst complex component 7
sheep(101106022) exocyst complex component 7
Domestic Rabbit(100340957) exocyst complex component 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013839 Rosetta Predictions human pricing
NM_015219 Rosetta Predictions human pricing
NM_022691 Rosetta Predictions rat pricing
NM_016857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013839 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148515 predicted 2173
2 SASI_Hs01_00148516 predicted 2053
3 SASI_Hs02_00306497 predicted 1363
4 SASI_Hs01_00148517 predicted 365
5 SASI_Hs01_00148518 predicted 1559
6 SASI_Hs01_00148519 predicted 1793
7 SASI_Hs01_00148520 predicted 1872
8 SASI_Hs01_00148521 predicted 550
9 SASI_Hs01_00148522 predicted 202
10 SASI_Hs01_00148523 predicted 218
11 SASI_Hs01_00148524 predicted 2102
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122648 predicted 2075
2 SASI_Hs01_00122649 predicted 1953
3 SASI_Hs02_00347328 predicted 1271
4 SASI_Hs01_00122650 predicted 364
5 SASI_Hs01_00122651 predicted 1461
6 SASI_Hs01_00122652 predicted 1702
7 SASI_Hs01_00122653 predicted 1777
8 SASI_Hs01_00122654 predicted 544
9 SASI_Hs01_00122655 predicted 211
10 SASI_Hs01_00122656 predicted 218
11 SASI_Hs01_00122657 predicted 2009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085477 predicted 407
2 SASI_Rn01_00085478 predicted 1725
3 SASI_Rn01_00085479 predicted 1103
4 SASI_Rn01_00085480 predicted 2037
5 SASI_Rn02_00263483 predicted 1939
6 SASI_Rn01_00085482 predicted 682
7 SASI_Rn01_00085483 predicted 1306
8 SASI_Rn01_00085484 predicted 1085
9 SASI_Rn01_00085485 predicted 924
10 SASI_Rn01_00085486 predicted 1253
11 SASI_Rn01_00085481 predicted 1550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114281 predicted 1799
2 SASI_Mm01_00114282 predicted 1814
3 SASI_Mm01_00114283 predicted 615
4 SASI_Mm01_00114284 predicted 1769
5 SASI_Mm01_00114285 predicted 1460
6 SASI_Mm01_00114286 predicted 839
7 SASI_Mm01_00114287 predicted 1270
8 SASI_Mm01_00114288 predicted 1024
9 SASI_Mm01_00114289 predicted 1828
10 SASI_Mm01_00114290 predicted 876
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016857
VALIDATED
EXOC7 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1678s21c1
Sequence:CCGGTCCTACACAACAACTACAATTCTCGAGAATTGTAGTTGTTGTGTAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-128s21c1
Sequence:CCGGGGAGGAGACGCTGTCGTTTATCTCGAGATAAACGACAGCGTCTCCTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-893s21c1
Sequence:CCGGGAACCTTCTGAAACAGTATTCCTCGAGGAATACTGTTTCAGAAGGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1939s21c1
Sequence:CCGGTCGAAGAGCTGTGCAAGATTCCTCGAGGAATCTTGCACAGCTCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-308s21c1
Sequence:CCGGATCCTGCCTGGACCACGTTATCTCGAGATAACGTGGTCCAGGCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-2199s21c1
Sequence:CCGGGCATGTCATTGGACTCATAAACTCGAGTTTATGAGTCCAATGACATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-631s1c1
Sequence:CCGGCGGAACCAAGACTTCATGAATCTCGAGATTCATGAAGTCTTGGTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-1833s1c1
Sequence:CCGGGCAGATGATTAAGGAACGTTTCTCGAGAAACGTTCCTTAATCATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016857.1-1285s1c1
Sequence:CCGGGCTGATAACATCGAGAATGATCTCGAGATCATTCTCGATGTTATCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-250s1c1
Sequence:CCGGCTGGACCACGTTATCAGCTATCTCGAGATAGCTGATAACGTGGTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016857
VALIDATED
EXOC7 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1678s21c1
Sequence:CCGGTCCTACACAACAACTACAATTCTCGAGAATTGTAGTTGTTGTGTAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-128s21c1
Sequence:CCGGGGAGGAGACGCTGTCGTTTATCTCGAGATAAACGACAGCGTCTCCTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-893s21c1
Sequence:CCGGGAACCTTCTGAAACAGTATTCCTCGAGGAATACTGTTTCAGAAGGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000377153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1939s21c1
Sequence:CCGGTCGAAGAGCTGTGCAAGATTCCTCGAGGAATCTTGCACAGCTCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-308s21c1
Sequence:CCGGATCCTGCCTGGACCACGTTATCTCGAGATAACGTGGTCCAGGCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-2199s21c1
Sequence:CCGGGCATGTCATTGGACTCATAAACTCGAGTTTATGAGTCCAATGACATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-631s1c1
Sequence:CCGGCGGAACCAAGACTTCATGAATCTCGAGATTCATGAAGTCTTGGTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-1833s1c1
Sequence:CCGGGCAGATGATTAAGGAACGTTTCTCGAGAAACGTTCCTTAATCATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016857.1-1285s1c1
Sequence:CCGGGCTGATAACATCGAGAATGATCTCGAGATCATTCTCGATGTTATCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-250s1c1
Sequence:CCGGCTGGACCACGTTATCAGCTATCTCGAGATAGCTGATAACGTGGTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016857
VALIDATED
EXOC7 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1678s21c1
Sequence:CCGGTCCTACACAACAACTACAATTCTCGAGAATTGTAGTTGTTGTGTAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-128s21c1
Sequence:CCGGGGAGGAGACGCTGTCGTTTATCTCGAGATAAACGACAGCGTCTCCTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-893s21c1
Sequence:CCGGGAACCTTCTGAAACAGTATTCCTCGAGGAATACTGTTTCAGAAGGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000377153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-1939s21c1
Sequence:CCGGTCGAAGAGCTGTGCAAGATTCCTCGAGGAATCTTGCACAGCTCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-308s21c1
Sequence:CCGGATCCTGCCTGGACCACGTTATCTCGAGATAACGTGGTCCAGGCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366721    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_016857.2-2199s21c1
Sequence:CCGGGCATGTCATTGGACTCATAAACTCGAGTTTATGAGTCCAATGACATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-631s1c1
Sequence:CCGGCGGAACCAAGACTTCATGAATCTCGAGATTCATGAAGTCTTGGTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-1833s1c1
Sequence:CCGGGCAGATGATTAAGGAACGTTTCTCGAGAAACGTTCCTTAATCATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016857.1-1285s1c1
Sequence:CCGGGCTGATAACATCGAGAATGATCTCGAGATCATTCTCGATGTTATCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_016857.1-250s1c1
Sequence:CCGGCTGGACCACGTTATCAGCTATCTCGAGATAGCTGATAACGTGGTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015219
VALIDATED
EXOC7 MISSION shRNA Bacterial Glycerol Stock
exocyst complex component 7
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1784s21c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-719s21c1
Sequence:CCGGCCAAGATTTCATGAACGTCTACTCGAGTAGACGTTCATGAAATCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-188s21c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1565s21c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-219s1c1
Sequence:CCGGGCTGCAGGAGAATGTTGAGAACTCGAGTTCTCAACATTCTCCTGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1485s1c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-117s1c1
Sequence:CCGGCACTAAGAACATGGTGTCTATCTCGAGATAGACACCATGTTCTTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1704s1c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-696s1c1
Sequence:CCGGCAAAGGACAGAAGGAGCATTTCTCGAGAAATGCTCCTTCTGTCCTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-1887s1c1
Sequence:CCGGGAACCCGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCGGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-108s1c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015219
VALIDATED
EXOC7 MISSION shRNA shRNA Plasmid DNA
exocyst complex component 7
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1784s21c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-719s21c1
Sequence:CCGGCCAAGATTTCATGAACGTCTACTCGAGTAGACGTTCATGAAATCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-188s21c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1565s21c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-219s1c1
Sequence:CCGGGCTGCAGGAGAATGTTGAGAACTCGAGTTCTCAACATTCTCCTGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1485s1c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-117s1c1
Sequence:CCGGCACTAAGAACATGGTGTCTATCTCGAGATAGACACCATGTTCTTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1704s1c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-696s1c1
Sequence:CCGGCAAAGGACAGAAGGAGCATTTCTCGAGAAATGCTCCTTCTGTCCTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-1887s1c1
Sequence:CCGGGAACCCGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCGGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-108s1c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015219
VALIDATED
EXOC7 MISSION shRNA Lentiviral Transduction Particles
exocyst complex component 7
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1784s21c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-719s21c1
Sequence:CCGGCCAAGATTTCATGAACGTCTACTCGAGTAGACGTTCATGAAATCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-188s21c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015219.2-1565s21c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-219s1c1
Sequence:CCGGGCTGCAGGAGAATGTTGAGAACTCGAGTTCTCAACATTCTCCTGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1485s1c1
Sequence:CCGGCCTGCACAACAACTACAATTACTCGAGTAATTGTAGTTGTTGTGCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-117s1c1
Sequence:CCGGCACTAAGAACATGGTGTCTATCTCGAGATAGACACCATGTTCTTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-1704s1c1
Sequence:CCGGGCAGATTATCAAGGAGCGTTTCTCGAGAAACGCTCCTTGATAATCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136419    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-696s1c1
Sequence:CCGGCAAAGGACAGAAGGAGCATTTCTCGAGAAATGCTCCTTCTGTCCTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136694    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015219.1-1887s1c1
Sequence:CCGGGAACCCGGAGAAGTACATCAACTCGAGTTGATGTACTTCTCCGGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015219.1-108s1c1
Sequence:CCGGCGACCAGCTCACTAAGAACATCTCGAGATGTTCTTAGTGAGCTGGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)