EMAIL THIS PAGE TO A FRIEND

EXOG

endo/exonuclease (5'-3'), endonuclease G-like

59 Gene Product Result for
Synonyms: ENDOGL1 ENDOGL2 ENGL ENGL-a ENGL-b ENGLA ENGLB
UniProtKB ID: Q9Y2C4, A8K242, B4DVG2, Q3SXM9, Q9Y2C8
Gene ID:
Human(9941) Summary: This gene encodes an endo/exonuclease with 5'-3' exonuclease activity. The encoded enzyme catalyzes the hydrolysis of ester linkages at the 5' end of a nucleic acid chain. This enzyme is localized to the mitochondria and may play a role in programmed cell death. Alternatively spliced transcript variants have been described. A pseudogene exists on chromosome 18. [provided by RefSeq, Feb 2009]
Mouse(208194) endo/exonuclease (5'-3'), endonuclease G-like
Rat(301062) endo/exonuclease (5'-3'), endonuclease G-like
domestic guinea pig(100723068) endo/exonuclease (5'-3'), endonuclease G-like
naked mole-rat(101710473) endo/exonuclease (5'-3'), endonuclease G-like
sheep(101111131) endo/exonuclease (5'-3'), endonuclease G-like
Zebrafish(100331954) nuclease EXOG, mitochondrial-like
cow(524343) endo/exonuclease (5'-3'), endonuclease G-like
Horse(100049888) endo/exonuclease (5'-3'), endonuclease G-like
domestic cat(101101248) endo/exonuclease (5'-3'), endonuclease G-like
dog(485591) endo/exonuclease (5'-3'), endonuclease G-like
chicken(420430) endo/exonuclease (5'-3'), endonuclease G-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005107 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005107 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005107 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172456 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172456 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172456 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005107 Rosetta Predictions human pricing
NM_001106866 Rosetta Predictions rat pricing
NM_172456 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005107 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052048 predicted 914
2 SASI_Hs01_00052049 predicted 245
3 SASI_Hs01_00052050 predicted 983
4 SASI_Hs01_00052051 predicted 970
5 SASI_Hs01_00052052 predicted 537
6 SASI_Hs01_00052053 predicted 882
7 SASI_Hs01_00052055 predicted 256
8 SASI_Hs02_00338993 predicted 252
9 SASI_Hs01_00052056 predicted 735
10 SASI_Hs02_00338994 predicted 877
11 SASI_Hs01_00052054 predicted 637
12 SASI_Hs01_00052057 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223176 predicted 423
2 SASI_Rn02_00223177 predicted 619
3 SASI_Rn02_00223178 predicted 224
4 SASI_Rn02_00223179 predicted 271
5 SASI_Rn02_00223180 predicted 659
6 SASI_Rn02_00223181 predicted 600
7 SASI_Rn02_00223182 predicted 359
8 SASI_Rn02_00223183 predicted 223
9 SASI_Rn02_00223184 predicted 664
10 SASI_Rn02_00223185 predicted 796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172456 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096080 predicted 1401
2 SASI_Mm01_00096081 predicted 1421
3 SASI_Mm01_00096082 predicted 665
4 SASI_Mm01_00096083 predicted 308
5 SASI_Mm01_00096084 predicted 583
6 SASI_Mm02_00343974 predicted 507
7 SASI_Mm01_00096085 predicted 781
8 SASI_Mm01_00096086 predicted 600
9 SASI_Mm01_00096087 predicted 256
10 SASI_Mm01_00096088 predicted 621
11 SASI_Mm01_00096089 predicted 855
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005107
VALIDATED
EXOG MISSION shRNA Bacterial Glycerol Stock
endo/exonuclease (5'-3'), endonuclease G-like
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-371s21c1
Sequence:CCGGGATGGGTTCTTGAACATATTTCTCGAGAAATATGTTCAAGAACCCATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-436s21c1
Sequence:CCGGTTTAAGCCTGATCCCAATATCCTCGAGGATATTGGGATCAGGCTTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005107.3-1249s21c1
Sequence:CCGGGCCCTCTTTAGGCTAACATATCTCGAGATATGTTAGCCTAAAGAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-616s21c1
Sequence:CCGGTATTGGAACAGAATAGAAATGCTCGAGCATTTCTATTCTGTTCCAATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-1030s1c1
Sequence:CCGGGCAGAGATTGAACCAGATGATCTCGAGATCATCTGGTTCAATCTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-1077s1c1
Sequence:CCGGGCTAGAAGAACTCAAAGCTAACTCGAGTTAGCTTTGAGTTCTTCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-939s1c1
Sequence:CCGGCCAGGAGTTCACCTTGTACTTCTCGAGAAGTACAAGGTGAACTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-403s1c1
Sequence:CCGGGCCTTCAATGAAGATTATGTTCTCGAGAACATAATCTTCATTGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-620s1c1
Sequence:CCGGCTTTGACCTTACCTCAGACTACTCGAGTAGTCTGAGGTAAGGTCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005107
VALIDATED
EXOG MISSION shRNA shRNA Plasmid DNA
endo/exonuclease (5'-3'), endonuclease G-like
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-371s21c1
Sequence:CCGGGATGGGTTCTTGAACATATTTCTCGAGAAATATGTTCAAGAACCCATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-436s21c1
Sequence:CCGGTTTAAGCCTGATCCCAATATCCTCGAGGATATTGGGATCAGGCTTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005107.3-1249s21c1
Sequence:CCGGGCCCTCTTTAGGCTAACATATCTCGAGATATGTTAGCCTAAAGAGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-616s21c1
Sequence:CCGGTATTGGAACAGAATAGAAATGCTCGAGCATTTCTATTCTGTTCCAATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-1030s1c1
Sequence:CCGGGCAGAGATTGAACCAGATGATCTCGAGATCATCTGGTTCAATCTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-1077s1c1
Sequence:CCGGGCTAGAAGAACTCAAAGCTAACTCGAGTTAGCTTTGAGTTCTTCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-939s1c1
Sequence:CCGGCCAGGAGTTCACCTTGTACTTCTCGAGAAGTACAAGGTGAACTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-403s1c1
Sequence:CCGGGCCTTCAATGAAGATTATGTTCTCGAGAACATAATCTTCATTGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000049857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-620s1c1
Sequence:CCGGCTTTGACCTTACCTCAGACTACTCGAGTAGTCTGAGGTAAGGTCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005107
VALIDATED
EXOG MISSION shRNA Lentiviral Transduction Particles
endo/exonuclease (5'-3'), endonuclease G-like
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-371s21c1
Sequence:CCGGGATGGGTTCTTGAACATATTTCTCGAGAAATATGTTCAAGAACCCATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-436s21c1
Sequence:CCGGTTTAAGCCTGATCCCAATATCCTCGAGGATATTGGGATCAGGCTTAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005107.3-1249s21c1
Sequence:CCGGGCCCTCTTTAGGCTAACATATCTCGAGATATGTTAGCCTAAAGAGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005107.3-616s21c1
Sequence:CCGGTATTGGAACAGAATAGAAATGCTCGAGCATTTCTATTCTGTTCCAATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-1030s1c1
Sequence:CCGGGCAGAGATTGAACCAGATGATCTCGAGATCATCTGGTTCAATCTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-1077s1c1
Sequence:CCGGGCTAGAAGAACTCAAAGCTAACTCGAGTTAGCTTTGAGTTCTTCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049855    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-939s1c1
Sequence:CCGGCCAGGAGTTCACCTTGTACTTCTCGAGAAGTACAAGGTGAACTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005107.1-403s1c1
Sequence:CCGGGCCTTCAATGAAGATTATGTTCTCGAGAACATAATCTTCATTGAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000049857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005107.1-620s1c1
Sequence:CCGGCTTTGACCTTACCTCAGACTACTCGAGTAGTCTGAGGTAAGGTCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172456
EXOG MISSION shRNA Bacterial Glycerol Stock
endo/exonuclease (5'-3'), endonuclease G-like
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172456.1-1998s1c1
Sequence:CCGGGCATTGTGTTTGCCTCCGATACTCGAGTATCGGAGGCAAACACAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-586s1c1
Sequence:CCGGCGGAGAGATTTGAAGATGTTTCTCGAGAAACATCTTCAAATCTCTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-272s1c1
Sequence:CCGGCCTGTCTTACGATCAGGCAAACTCGAGTTTGCCTGATCGTAAGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-707s1c1
Sequence:CCGGGCACCTTTACAAGGTGATCCTCTCGAGAGGATCACCTTGTAAAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172456
EXOG MISSION shRNA shRNA Plasmid DNA
endo/exonuclease (5'-3'), endonuclease G-like
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172456.1-1998s1c1
Sequence:CCGGGCATTGTGTTTGCCTCCGATACTCGAGTATCGGAGGCAAACACAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-586s1c1
Sequence:CCGGCGGAGAGATTTGAAGATGTTTCTCGAGAAACATCTTCAAATCTCTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000201610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-272s1c1
Sequence:CCGGCCTGTCTTACGATCAGGCAAACTCGAGTTTGCCTGATCGTAAGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-707s1c1
Sequence:CCGGGCACCTTTACAAGGTGATCCTCTCGAGAGGATCACCTTGTAAAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172456
EXOG MISSION shRNA Lentiviral Transduction Particles
endo/exonuclease (5'-3'), endonuclease G-like
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201784    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172456.1-1998s1c1
Sequence:CCGGGCATTGTGTTTGCCTCCGATACTCGAGTATCGGAGGCAAACACAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-586s1c1
Sequence:CCGGCGGAGAGATTTGAAGATGTTTCTCGAGAAACATCTTCAAATCTCTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000201610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-272s1c1
Sequence:CCGGCCTGTCTTACGATCAGGCAAACTCGAGTTTGCCTGATCGTAAGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172456.1-707s1c1
Sequence:CCGGGCACCTTTACAAGGTGATCCTCTCGAGAGGATCACCTTGTAAAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)