EMAIL THIS PAGE TO A FRIEND

EXOSC10

exosome component 10

69 Gene Product Result for
Synonyms: PM-Scl PM/Scl-100 PMSCL PMSCL2 RRP6 Rrp6p p2 p3 p4
UniProtKB ID: Q01780, B1AKQ0, B1AKQ1, Q15158
Gene ID:
Mouse(50912) exosome component 10
Rat(313707) exosome component 10
domestic guinea pig(100718123) exosome component 10
naked mole-rat(101725993) exosome component 10
sheep(101113610) exosome component 10
Domestic Rabbit(100355915) exosome component 10
Zebrafish(394064) exosome component 10
domestic cat(101097743) exosome component 10
cow(535340) exosome component 10
Horse(100056644) exosome component 10
dog(478233) exosome component 10
chicken(419454) exosome component 10
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001998 Rosetta Predictions human pricing
NM_002685 Rosetta Predictions human pricing
XR_007065 Rosetta Predictions rat pricing
NM_016699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183400 predicted 1189
2 SASI_Hs01_00183401 predicted 876
3 SASI_Hs01_00183402 predicted 1545
4 SASI_Hs01_00183403 predicted 210
5 SASI_Hs01_00183404 predicted 798
6 SASI_Hs01_00183405 predicted 1136
7 SASI_Hs02_00304064 predicted 797
8 SASI_Hs01_00183407 predicted 800
9 SASI_Hs02_00304065 predicted 1084
10 SASI_Hs02_00304066 predicted 375
11 SASI_Hs01_00183406 predicted 958
12 SASI_Hs01_00183408 predicted 1088
13 SASI_Hs01_00183409 predicted 1676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00085253 predicted 1187
2 SASI_Hs01_00085254 predicted 877
3 SASI_Hs01_00085255 predicted 1547
4 SASI_Hs01_00085256 predicted 204
5 SASI_Hs01_00085257 predicted 799
6 SASI_Hs01_00085258 predicted 1134
7 SASI_Hs02_00334246 predicted 799
8 SASI_Hs01_00085260 predicted 803
9 SASI_Hs02_00334247 predicted 1082
10 SASI_Hs02_00334248 predicted 374
11 SASI_Hs01_00085259 predicted 965
12 SASI_Hs01_00085261 predicted 1086
13 SASI_Hs01_00085262 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00158609 predicted 2091
2 SASI_Rn02_00413592 predicted 752
3 SASI_Rn01_00158610 predicted 1372
4 SASI_Rn01_00158611 predicted 2156
5 SASI_Rn01_00158613 predicted 341
6 SASI_Rn01_00158614 predicted 1181
7 SASI_Rn02_00413593 predicted 977
8 SASI_Rn01_00158616 predicted 2240
9 SASI_Rn02_00413594 predicted 2061
10 SASI_Rn01_00158617 predicted 1625
11 SASI_Rn01_00158612 predicted 1479
12 SASI_Rn01_00158615 predicted 820
13 SASI_Rn01_00158618 predicted 357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138650 predicted 2119
2 SASI_Mm01_00138651 predicted 1333
3 SASI_Mm01_00138652 predicted 1703
4 SASI_Mm01_00138653 predicted 222
5 SASI_Mm01_00138654 predicted 2207
6 SASI_Mm01_00138655 predicted 937
7 SASI_Mm01_00138656 predicted 779
8 SASI_Mm01_00138657 predicted 573
9 SASI_Mm01_00138658 predicted 1149
10 SASI_Mm02_00323365 predicted 1595
11 SASI_Mm01_00138659 predicted 1047
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002685
VALIDATED
EXOSC10 MISSION shRNA Bacterial Glycerol Stock
exosome component 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002685.2-144s21c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1845s21c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1369s21c1
Sequence:CCGGACACCCATTACCTGCTATATACTCGAGTATATAGCAGGTAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-2572s21c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1833s1c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1274s1c1
Sequence:CCGGCGTGGACTCAAACAAGCAATACTCGAGTATTGCTTGTTTGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002685.1-2560s1c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1116s1c1
Sequence:CCGGGCCATCGTTAAGGTCTTTCATCTCGAGATGAAAGACCTTAACGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-132s1c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002685
VALIDATED
EXOSC10 MISSION shRNA shRNA Plasmid DNA
exosome component 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002685.2-144s21c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1845s21c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1369s21c1
Sequence:CCGGACACCCATTACCTGCTATATACTCGAGTATATAGCAGGTAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-2572s21c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1833s1c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1274s1c1
Sequence:CCGGCGTGGACTCAAACAAGCAATACTCGAGTATTGCTTGTTTGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002685.1-2560s1c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1116s1c1
Sequence:CCGGGCCATCGTTAAGGTCTTTCATCTCGAGATGAAAGACCTTAACGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-132s1c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002685
VALIDATED
EXOSC10 MISSION shRNA Lentiviral Transduction Particles
exosome component 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_002685.2-144s21c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1845s21c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-1369s21c1
Sequence:CCGGACACCCATTACCTGCTATATACTCGAGTATATAGCAGGTAATGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002685.2-2572s21c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1833s1c1
Sequence:CCGGGCTGAGAGATTGGAGAATGTTCTCGAGAACATTCTCCAATCTCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1274s1c1
Sequence:CCGGCGTGGACTCAAACAAGCAATACTCGAGTATTGCTTGTTTGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_002685.1-2560s1c1
Sequence:CCGGGCATGTCCTTTCCAACTGGAACTCGAGTTCCAGTTGGAAAGGACATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-1116s1c1
Sequence:CCGGGCCATCGTTAAGGTCTTTCATCTCGAGATGAAAGACCTTAACGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002685.1-132s1c1
Sequence:CCGGGCCGACAGCTTTGTGAAGTTTCTCGAGAAACTTCACAAAGCTGTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016699
EXOSC10 MISSION shRNA Bacterial Glycerol Stock
exosome component 10
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-817s21c1
Sequence:CCGGAGTATGAACTGGATCACTTTACTCGAGTAAAGTGATCCAGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-338s21c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-382s21c1
Sequence:CCGGTCGATACCAATGACGTGATATCTCGAGATATCACGTCATTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-206s21c1
Sequence:CCGGGTTCGGTGACGAGTATGATTTCTCGAGAAATCATACTCGTCACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-1278s21c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1805s1c1
Sequence:CCGGGCCGAGAGATTGGAGAATGATCTCGAGATCATTCTCCAATCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-583s1c1
Sequence:CCGGCGACAATTCTAACACACCATTCTCGAGAATGGTGTGTTAGAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1855s1c1
Sequence:CCGGCCCTCCAGATAACTACCAGAACTCGAGTTCTGGTAGTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1247s1c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-307s1c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016699
EXOSC10 MISSION shRNA shRNA Plasmid DNA
exosome component 10
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-817s21c1
Sequence:CCGGAGTATGAACTGGATCACTTTACTCGAGTAAAGTGATCCAGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-338s21c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-382s21c1
Sequence:CCGGTCGATACCAATGACGTGATATCTCGAGATATCACGTCATTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-206s21c1
Sequence:CCGGGTTCGGTGACGAGTATGATTTCTCGAGAAATCATACTCGTCACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-1278s21c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1805s1c1
Sequence:CCGGGCCGAGAGATTGGAGAATGATCTCGAGATCATTCTCCAATCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-583s1c1
Sequence:CCGGCGACAATTCTAACACACCATTCTCGAGAATGGTGTGTTAGAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1855s1c1
Sequence:CCGGCCCTCCAGATAACTACCAGAACTCGAGTTCTGGTAGTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1247s1c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-307s1c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016699
EXOSC10 MISSION shRNA Lentiviral Transduction Particles
exosome component 10
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-817s21c1
Sequence:CCGGAGTATGAACTGGATCACTTTACTCGAGTAAAGTGATCCAGTTCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-338s21c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-382s21c1
Sequence:CCGGTCGATACCAATGACGTGATATCTCGAGATATCACGTCATTGGTATCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-206s21c1
Sequence:CCGGGTTCGGTGACGAGTATGATTTCTCGAGAAATCATACTCGTCACCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016699.2-1278s21c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123544    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1805s1c1
Sequence:CCGGGCCGAGAGATTGGAGAATGATCTCGAGATCATTCTCCAATCTCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-583s1c1
Sequence:CCGGCGACAATTCTAACACACCATTCTCGAGAATGGTGTGTTAGAATTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123547    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1855s1c1
Sequence:CCGGCCCTCCAGATAACTACCAGAACTCGAGTTCTGGTAGTTATCTGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123548    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-1247s1c1
Sequence:CCGGGTGGAATCAAACAAGCAATATCTCGAGATATTGCTTGTTTGATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123546    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016699.1-307s1c1
Sequence:CCGGCCGAAGTAAAGTGACTGAATTCTCGAGAATTCAGTCACTTTACTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks