EMAIL THIS PAGE TO A FRIEND

EXOSC1

exosome component 1

53 Gene Product Result for
Synonyms: CGI-108 CSL4 Csl4p SKI4 Ski4p hCsl4p p13
UniProtKB ID: Q9Y3B2, B2R9B3, Q5JTH3
Gene ID:
Human(51013) Summary: This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. [provided by RefSeq, Jul 2008]
Mouse(66583) exosome component 1
Rat(679140) exosome component 1
Zebrafish(558857) exosome component 1
dog(477787) exosome component 1
domestic cat(101099329) exosome component 1
cow(506018) exosome component 1
chicken(423844) exosome component 1
sheep(101113810) exosome component 1
naked mole-rat(101725849) exosome component 1
domestic guinea pig(100719104) exosome component 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016046 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025644 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025644 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025644 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU035041 MISSION® esiRNA esiRNA targeting mouse Exosc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016046 Rosetta Predictions human pricing
XM_001054866 Rosetta Predictions rat pricing
NM_025644 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022981 predicted 465
2 SASI_Hs01_00022983 predicted 552
3 SASI_Hs02_00348766 predicted 752
4 SASI_Hs01_00022984 predicted 505
5 SASI_Hs01_00022985 predicted 333
6 SASI_Hs01_00022986 predicted 199
7 SASI_Hs01_00022987 predicted 366
8 SASI_Hs01_00022988 predicted 527
9 SASI_Hs01_00022989 predicted 213
10 SASI_Hs01_00022990 predicted 542
11 SASI_Hs01_00022982 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054866 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00277547 predicted 693
2 SASI_Rn02_00277548 predicted 684
3 SASI_Rn02_00277549 predicted 650
4 SASI_Rn02_00277550 predicted 698
5 SASI_Rn02_00277551 predicted 535
6 SASI_Rn02_00277552 predicted 313
7 SASI_Rn02_00277553 predicted 364
8 SASI_Rn02_00277554 predicted 216
9 SASI_Rn02_00277555 predicted 411
10 SASI_Rn02_00277556 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025644 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193600 predicted 580
2 SASI_Mm01_00193601 predicted 354
3 SASI_Mm01_00193602 predicted 503
4 SASI_Mm02_00328744 predicted 244
5 SASI_Mm01_00193604 predicted 224
6 SASI_Mm02_00328745 predicted 213
7 SASI_Mm01_00193605 predicted 482
8 SASI_Mm01_00193606 predicted 325
9 SASI_Mm01_00193607 predicted 542
10 SASI_Mm02_00328746 predicted 617
11 SASI_Mm01_00193603 predicted 253
12 SASI_Mm01_00193608 predicted 261
13 SASI_Mm01_00193609 predicted 486
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016046
VALIDATED
EXOSC1 MISSION shRNA Bacterial Glycerol Stock
exosome component 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-256s1c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-567s1c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-163s1c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-540s1c1
Sequence:CCGGCCACACTAAAGAATTCCGGAACTCGAGTTCCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-235s1c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-252s21c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-584s21c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-180s21c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-273s21c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016046
VALIDATED
EXOSC1 MISSION shRNA shRNA Plasmid DNA
exosome component 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-256s1c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-567s1c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-163s1c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-540s1c1
Sequence:CCGGCCACACTAAAGAATTCCGGAACTCGAGTTCCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-235s1c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-252s21c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-584s21c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-180s21c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-273s21c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016046
VALIDATED
EXOSC1 MISSION shRNA Lentiviral Transduction Particles
exosome component 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-256s1c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050396    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-567s1c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-163s1c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016046.2-540s1c1
Sequence:CCGGCCACACTAAAGAATTCCGGAACTCGAGTTCCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050395    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016046.2-235s1c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-252s21c1
Sequence:CCGGTCTAGCATCAATTCACGCTTTCTCGAGAAAGCGTGAATTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-584s21c1
Sequence:CCGGCCGAGTACAACCCGAATTCTTCTCGAGAAGAATTCGGGTTGTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_016046.3-180s21c1
Sequence:CCGGGTGGTGTCTGTAGTGAGAGAACTCGAGTTCTCTCACTACAGACACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016046.3-273s21c1
Sequence:CCGGGCCAAAGTACACATCCTGTATCTCGAGATACAGGATGTGTACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025644
VALIDATED
EXOSC1 MISSION shRNA Bacterial Glycerol Stock
exosome component 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-706s1c1
Sequence:CCGGGCTGGCAACCATCTCTTGAAACTCGAGTTTCAAGAGATGGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-543s1c1
Sequence:CCGGCCACACTAAAGAATTCCGAAACTCGAGTTTCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-238s1c1
Sequence:CCGGTCTAGCATCAACTCACGGTTTCTCGAGAAACCGTGAGTTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-49s1c1
Sequence:CCGGCGTCTGTGTAACTTGGAGGAACTCGAGTTCCTCCAAGTTACACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-310s1c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-601s21c1
Sequence:CCGGCCGAGTTCCTACAGACCTAAGCTCGAGCTTAGGTCTGTAGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.4-114s21c1
Sequence:CCGGACCCGGCATGGCTACATCTTTCTCGAGAAAGATGTAGCCATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-646s21c1
Sequence:CCGGAGCACTTCAGCTACTTCTAAACTCGAGTTTAGAAGTAGCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.3-310s21c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-239s21c1
Sequence:CCGGCTAGCATCAACTCACGGTTTGCTCGAGCAAACCGTGAGTTGATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025644.3-669s21c1
Sequence:CCGGCAAGATGCAATGGTCTTTATTCTCGAGAATAAAGACCATTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-376s21c1
Sequence:CCGGTTTCGGCCAGGTGACATAGTTCTCGAGAACTATGTCACCTGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025644
VALIDATED
EXOSC1 MISSION shRNA shRNA Plasmid DNA
exosome component 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-706s1c1
Sequence:CCGGGCTGGCAACCATCTCTTGAAACTCGAGTTTCAAGAGATGGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-543s1c1
Sequence:CCGGCCACACTAAAGAATTCCGAAACTCGAGTTTCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-238s1c1
Sequence:CCGGTCTAGCATCAACTCACGGTTTCTCGAGAAACCGTGAGTTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-49s1c1
Sequence:CCGGCGTCTGTGTAACTTGGAGGAACTCGAGTTCCTCCAAGTTACACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-310s1c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-601s21c1
Sequence:CCGGCCGAGTTCCTACAGACCTAAGCTCGAGCTTAGGTCTGTAGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.4-114s21c1
Sequence:CCGGACCCGGCATGGCTACATCTTTCTCGAGAAAGATGTAGCCATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-646s21c1
Sequence:CCGGAGCACTTCAGCTACTTCTAAACTCGAGTTTAGAAGTAGCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.3-310s21c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-239s21c1
Sequence:CCGGCTAGCATCAACTCACGGTTTGCTCGAGCAAACCGTGAGTTGATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025644.3-669s21c1
Sequence:CCGGCAAGATGCAATGGTCTTTATTCTCGAGAATAAAGACCATTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-376s21c1
Sequence:CCGGTTTCGGCCAGGTGACATAGTTCTCGAGAACTATGTCACCTGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025644
VALIDATED
EXOSC1 MISSION shRNA Lentiviral Transduction Particles
exosome component 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120762    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-706s1c1
Sequence:CCGGGCTGGCAACCATCTCTTGAAACTCGAGTTTCAAGAGATGGTTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-543s1c1
Sequence:CCGGCCACACTAAAGAATTCCGAAACTCGAGTTTCGGAATTCTTTAGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-238s1c1
Sequence:CCGGTCTAGCATCAACTCACGGTTTCTCGAGAAACCGTGAGTTGATGCTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025644.3-49s1c1
Sequence:CCGGCGTCTGTGTAACTTGGAGGAACTCGAGTTCCTCCAAGTTACACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_025644.3-310s1c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-601s21c1
Sequence:CCGGCCGAGTTCCTACAGACCTAAGCTCGAGCTTAGGTCTGTAGGAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.4-114s21c1
Sequence:CCGGACCCGGCATGGCTACATCTTTCTCGAGAAAGATGTAGCCATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375891    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.4-646s21c1
Sequence:CCGGAGCACTTCAGCTACTTCTAAACTCGAGTTTAGAAGTAGCTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352462    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025644.3-310s21c1
Sequence:CCGGCGAGGAACTATCCGCAAAGAACTCGAGTTCTTTGCGGATAGTTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-239s21c1
Sequence:CCGGCTAGCATCAACTCACGGTTTGCTCGAGCAAACCGTGAGTTGATGCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025644.3-669s21c1
Sequence:CCGGCAAGATGCAATGGTCTTTATTCTCGAGAATAAAGACCATTGCATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_025644.3-376s21c1
Sequence:CCGGTTTCGGCCAGGTGACATAGTTCTCGAGAACTATGTCACCTGGCCGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks