EMAIL THIS PAGE TO A FRIEND

EXOSC2

exosome component 2

64 Gene Product Result for
Synonyms: RRP4 Rrp4p hRrp4p p7
UniProtKB ID: Q13868, A3KFL3, Q9NUY4
Gene ID:
Mouse(227715) exosome component 2
Rat(366017) exosome component 2
Zebrafish(550234) exosome component 2
cow(615712) exosome component 2
domestic cat(101087181) exosome component 2
dog(608606) exosome component 2
chicken(417182) exosome component 2
sheep(101114760) exosome component 2
naked mole-rat(101724777) exosome component 2
domestic guinea pig(100730736) exosome component 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144886 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144886 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144886 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014285 Rosetta Predictions human pricing
NM_001108952 Rosetta Predictions rat pricing
XM_345336 Rosetta Predictions rat pricing
NM_144886 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230321 predicted 274
2 SASI_Hs01_00230323 predicted 569
3 SASI_Hs01_00230324 predicted 887
4 SASI_Hs02_00345369 predicted 207
5 SASI_Hs01_00230325 predicted 709
6 SASI_Hs01_00230326 predicted 235
7 SASI_Hs01_00230327 predicted 857
8 SASI_Hs01_00230328 predicted 600
9 SASI_Hs01_00230329 predicted 621
10 SASI_Hs01_00230330 predicted 827
11 SASI_Hs01_00230322 predicted 557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243704 predicted 272
2 SASI_Rn02_00243705 predicted 814
3 SASI_Rn02_00243706 predicted 595
4 SASI_Rn02_00243707 predicted 1147
5 SASI_Rn02_00243708 predicted 1169
6 SASI_Rn02_00243709 predicted 562
7 SASI_Rn02_00243710 predicted 405
8 SASI_Rn02_00243711 predicted 803
9 SASI_Rn02_00243712 predicted 707
10 SASI_Rn02_00243713 predicted 1172
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_345336 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141893 predicted 255
2 SASI_Rn01_00141894 predicted 804
3 SASI_Rn01_00141895 predicted 1355
4 SASI_Rn01_00141896 predicted 586
5 SASI_Rn01_00141897 predicted 1134
6 SASI_Rn01_00141898 predicted 1158
7 SASI_Rn01_00141899 predicted 1179
8 SASI_Rn01_00141900 predicted 547
9 SASI_Rn01_00141901 predicted 390
10 SASI_Rn01_00141902 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144886 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115439 predicted 1123
2 SASI_Mm01_00115440 predicted 259
3 SASI_Mm01_00115441 predicted 801
4 SASI_Mm01_00115442 predicted 1117
5 SASI_Mm02_00340336 predicted 842
6 SASI_Mm01_00115443 predicted 699
7 SASI_Mm01_00115444 predicted 579
8 SASI_Mm01_00115445 predicted 489
9 SASI_Mm01_00115447 predicted 1335
10 SASI_Mm01_00115448 predicted 1186
11 SASI_Mm01_00115446 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014285
VALIDATED
EXOSC2 MISSION shRNA Bacterial Glycerol Stock
exosome component 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-60s1c1
Sequence:CCGGCGCGACACTAAGAAACATCTACTCGAGTAGATGTTTCTTAGTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-752s1c1
Sequence:CCGGGCTGTATGATACCAGCATCCTCTCGAGAGGATGCTGGTATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014285.4-810s1c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-150s1c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-553s1c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1307s21c1
Sequence:CCGGTCCATTCCTATATCCTTTAAACTCGAGTTTAAAGGATATAGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014285.5-829s21c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-572s21c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-169s21c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1175s21c1
Sequence:CCGGGGGCTCCCATCCTGGAATAATCTCGAGATTATTCCAGGATGGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014285
VALIDATED
EXOSC2 MISSION shRNA shRNA Plasmid DNA
exosome component 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-60s1c1
Sequence:CCGGCGCGACACTAAGAAACATCTACTCGAGTAGATGTTTCTTAGTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-752s1c1
Sequence:CCGGGCTGTATGATACCAGCATCCTCTCGAGAGGATGCTGGTATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014285.4-810s1c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-150s1c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-553s1c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1307s21c1
Sequence:CCGGTCCATTCCTATATCCTTTAAACTCGAGTTTAAAGGATATAGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014285.5-829s21c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-572s21c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-169s21c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1175s21c1
Sequence:CCGGGGGCTCCCATCCTGGAATAATCTCGAGATTATTCCAGGATGGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014285
VALIDATED
EXOSC2 MISSION shRNA Lentiviral Transduction Particles
exosome component 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-60s1c1
Sequence:CCGGCGCGACACTAAGAAACATCTACTCGAGTAGATGTTTCTTAGTGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-752s1c1
Sequence:CCGGGCTGTATGATACCAGCATCCTCTCGAGAGGATGCTGGTATCATACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014285.4-810s1c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-150s1c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014285.4-553s1c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369627    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1307s21c1
Sequence:CCGGTCCATTCCTATATCCTTTAAACTCGAGTTTAAAGGATATAGGAATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014285.5-829s21c1
Sequence:CCGGGACATCTTAAAGCCAGAAATACTCGAGTATTTCTGGCTTTAAGATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318910    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-572s21c1
Sequence:CCGGCCCACTTTCATGATTTGCCATCTCGAGATGGCAAATCATGAAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-169s21c1
Sequence:CCGGGAGAAGCTCATTGCATCTGTTCTCGAGAACAGATGCAATGAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369628    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014285.5-1175s21c1
Sequence:CCGGGGGCTCCCATCCTGGAATAATCTCGAGATTATTCCAGGATGGGAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144886
VALIDATED
EXOSC2 MISSION shRNA Bacterial Glycerol Stock
exosome component 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-1151s1c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-735s1c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-605s1c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-822s1c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-84s1c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-711s21c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-60s21c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-581s21c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144886.2-1127s21c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-798s21c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144886
VALIDATED
EXOSC2 MISSION shRNA shRNA Plasmid DNA
exosome component 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-1151s1c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-735s1c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-605s1c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-822s1c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-84s1c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-711s21c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-60s21c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-581s21c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144886.2-1127s21c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-798s21c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144886
VALIDATED
EXOSC2 MISSION shRNA Lentiviral Transduction Particles
exosome component 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-1151s1c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-735s1c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-605s1c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-822s1c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144886.1-84s1c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-711s21c1
Sequence:CCGGGCTTCGGAACTGTGTAGTCTTCTCGAGAAGACTACACAGTTCCGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-60s21c1
Sequence:CCGGCCGCGACTCTAAGAAACACTTCTCGAGAAGTGTTTCTTAGAGTCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-581s21c1
Sequence:CCGGCCTCAGTGATTCTGGGTAACACTCGAGTGTTACCCAGAATCACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302638    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144886.2-1127s21c1
Sequence:CCGGCCTTGGAATAACTTGGAGAATCTCGAGATTCTCCAAGTTATTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331551    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144886.2-798s21c1
Sequence:CCGGGCATCAGATCAAGGATATCTTCTCGAGAAGATATCCTTGATCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks