EMAIL THIS PAGE TO A FRIEND

EXOSC3

exosome component 3

74 Gene Product Result for
Synonyms: PCH1B RP11-3J10.8 RRP40 Rrp40p bA3J10.7 hRrp-40 p10
UniProtKB ID: Q9NQT5, A8K0K6, Q5QP85, Q9Y3A8
Gene ID:
Human(51010) Summary: This gene encodes a non-catalytic component of the human exosome, a complex with 3'-5' exoribonuclease activity that plays a role in numerous RNA processing and degradation activities. Related pseudogenes of this gene are found on chromosome 19 and 21. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jun 2012]
Mouse(66362) exosome component 3
Rat(313243) exosome component 3
domestic guinea pig(100714486) exosome component 3
naked mole-rat(101707251) exosome component 3
sheep(101106397) exosome component 3
Zebrafish(565000) exosome component 3
chicken(423626) exosome component 3
domestic cat(101081087) exosome component 3
cow(533245) exosome component 3
dog(481616) exosome component 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV40231 Anti-EXOSC3 (AB1) antibody produced in rabbit affinity isolated antibody mouse, rabbit, rat, guinea pig, horse, canine, bovine, human
immunohistochemistry, western blot pricing
AV40230 Anti-EXOSC3 (AB2) antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, rat, mouse, bovine, canine, human
western blot pricing
SAB1407430 Anti-EXOSC3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB2107976 Anti-EXOSC3 antibody produced in rabbit affinity isolated antibody canine, guinea pig, yeast, pig, bovine, zebrafish, rabbit, rat, human, mouse, horse
western blot pricing
AV40824 Anti-EXOSC3 antibody produced in rabbit IgG fraction of antiserum bovine, guinea pig, horse, canine, mouse, rabbit, human, rat
immunohistochemistry, western blot pricing
HPA020485 Anti-EXOSC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
WH0051010M3 Monoclonal Anti-EXOSC3 antibody produced in mouse clone 5C3, purified immunoglobulin, buffered aqueous solution mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB1405075 Monoclonal Anti-EXOSC3, (C-terminal) antibody produced in mouse clone 3E5, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002269 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002269 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002269 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025513 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025513 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025513 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002269 Rosetta Predictions human pricing
NM_016042 Rosetta Predictions human pricing
NM_001107936 Rosetta Predictions rat pricing
NM_025513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002269 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178965 predicted 252
2 SASI_Hs01_00178966 predicted 268
3 SASI_Hs01_00178967 predicted 265
4 SASI_Hs01_00178968 predicted 193
5 SASI_Hs01_00178969 predicted 198
6 SASI_Hs01_00178970 predicted 200
7 SASI_Hs01_00178971 predicted 200
8 SASI_Hs01_00178973 predicted 249
9 SASI_Hs01_00178974 predicted 267
10 SASI_Hs02_00304157 predicted 264
11 SASI_Hs01_00178972 predicted 252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187776 predicted 249
2 SASI_Hs01_00187777 predicted 275
3 SASI_Hs01_00187778 predicted 268
4 SASI_Hs01_00187779 predicted 202
5 SASI_Hs01_00187780 predicted 202
6 SASI_Hs01_00187781 predicted 202
7 SASI_Hs01_00187783 predicted 248
8 SASI_Hs01_00187784 predicted 269
9 SASI_Hs01_00187785 predicted 259
10 SASI_Hs02_00348763 predicted 268
11 SASI_Hs01_00187782 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233745 predicted 202
2 SASI_Rn02_00233746 predicted 688
3 SASI_Rn02_00233747 predicted 478
4 SASI_Rn02_00233748 predicted 488
5 SASI_Rn02_00233749 predicted 613
6 SASI_Rn02_00233750 predicted 551
7 SASI_Rn02_00233751 predicted 679
8 SASI_Rn02_00233752 predicted 71
9 SASI_Rn02_00233753 predicted 548
10 SASI_Rn02_00233754 predicted 339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328401 predicted 534
2 SASI_Mm02_00328402 predicted 617
3 SASI_Mm01_00182390 predicted 347
4 SASI_Mm01_00182391 predicted 503
5 SASI_Mm01_00182392 predicted 358
6 SASI_Mm01_00182393 predicted 482
7 SASI_Mm01_00182394 predicted 376
8 SASI_Mm01_00182395 predicted 466
9 SASI_Mm01_00182396 predicted 380
10 SASI_Mm01_00182397 predicted 601
11 SASI_Mm01_00182398 predicted 657
12 SASI_Mm01_00182399 predicted 624
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002269
VALIDATED
EXOSC3 MISSION shRNA Bacterial Glycerol Stock
exosome component 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-446s21c1
Sequence:CCGGTTTGTCTTACTTGTCATTTGACTCGAGTCAAATGACAAGTAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-487s21c1
Sequence:CCGGGACCAAATGTGCAGGCTATTACTCGAGTAATAGCCTGCACATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-515s21c1
Sequence:CCGGATTGTGAAATCATACAGGAAGCTCGAGCTTCCTGTATGATTTCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-336s21c1
Sequence:CCGGTCTCAGCAGAAGCGGTATGTTCTCGAGAACATACCGCTTCTGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-367s21c1
Sequence:CCGGGAGACCATGTGATTGGCATAGCTCGAGCTATGCCAATCACATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-417s21c1
Sequence:CCGCGTTGATGTTGGAGGGAGTGAGCTCGAGCTCACTCCCTCCAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002269.1-547s21c1
Sequence:CCGGTATCCACTGGAGATAGTATTTCTCGAGAAATACTATCTCCAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002269.1-780s1c1
Sequence:CCGGCTCAGAAGATAAGGTGTGAATCTCGAGATTCACACCTTATCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-344s1c1
Sequence:CCGGGAAGCGGTATGTTCCAGTAAACTCGAGTTTACTGGAACATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-497s1c1
Sequence:CCGGGCAGGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002269.1-377s1c1
Sequence:CCGGGATTGGCATAGTGACAGCTAACTCGAGTTAGCTGTCACTATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-437s1c1
Sequence:CCGGGCCAGCTTCTTTGTCTTACTTCTCGAGAAGTAAGACAAAGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002269
VALIDATED
EXOSC3 MISSION shRNA shRNA Plasmid DNA
exosome component 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-446s21c1
Sequence:CCGGTTTGTCTTACTTGTCATTTGACTCGAGTCAAATGACAAGTAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-487s21c1
Sequence:CCGGGACCAAATGTGCAGGCTATTACTCGAGTAATAGCCTGCACATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-515s21c1
Sequence:CCGGATTGTGAAATCATACAGGAAGCTCGAGCTTCCTGTATGATTTCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-336s21c1
Sequence:CCGGTCTCAGCAGAAGCGGTATGTTCTCGAGAACATACCGCTTCTGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-367s21c1
Sequence:CCGGGAGACCATGTGATTGGCATAGCTCGAGCTATGCCAATCACATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-417s21c1
Sequence:CCGCGTTGATGTTGGAGGGAGTGAGCTCGAGCTCACTCCCTCCAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002269.1-547s21c1
Sequence:CCGGTATCCACTGGAGATAGTATTTCTCGAGAAATACTATCTCCAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002269.1-780s1c1
Sequence:CCGGCTCAGAAGATAAGGTGTGAATCTCGAGATTCACACCTTATCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-344s1c1
Sequence:CCGGGAAGCGGTATGTTCCAGTAAACTCGAGTTTACTGGAACATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-497s1c1
Sequence:CCGGGCAGGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002269.1-377s1c1
Sequence:CCGGGATTGGCATAGTGACAGCTAACTCGAGTTAGCTGTCACTATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-437s1c1
Sequence:CCGGGCCAGCTTCTTTGTCTTACTTCTCGAGAAGTAAGACAAAGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002269
VALIDATED
EXOSC3 MISSION shRNA Lentiviral Transduction Particles
exosome component 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-446s21c1
Sequence:CCGGTTTGTCTTACTTGTCATTTGACTCGAGTCAAATGACAAGTAAGACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-487s21c1
Sequence:CCGGGACCAAATGTGCAGGCTATTACTCGAGTAATAGCCTGCACATTTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-515s21c1
Sequence:CCGGATTGTGAAATCATACAGGAAGCTCGAGCTTCCTGTATGATTTCACAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-336s21c1
Sequence:CCGGTCTCAGCAGAAGCGGTATGTTCTCGAGAACATACCGCTTCTGCTGAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-367s21c1
Sequence:CCGGGAGACCATGTGATTGGCATAGCTCGAGCTATGCCAATCACATGGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416539    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001002269.1-417s21c1
Sequence:CCGCGTTGATGTTGGAGGGAGTGAGCTCGAGCTCACTCCCTCCAACATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426298    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001002269.1-547s21c1
Sequence:CCGGTATCCACTGGAGATAGTATTTCTCGAGAAATACTATCTCCAGTGGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050408    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_001002269.1-780s1c1
Sequence:CCGGCTCAGAAGATAAGGTGTGAATCTCGAGATTCACACCTTATCTTCTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-344s1c1
Sequence:CCGGGAAGCGGTATGTTCCAGTAAACTCGAGTTTACTGGAACATACCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-497s1c1
Sequence:CCGGGCAGGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001002269.1-377s1c1
Sequence:CCGGGATTGGCATAGTGACAGCTAACTCGAGTTAGCTGTCACTATGCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050410    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001002269.1-437s1c1
Sequence:CCGGGCCAGCTTCTTTGTCTTACTTCTCGAGAAGTAAGACAAAGAAGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025513
VALIDATED
EXOSC3 MISSION shRNA Bacterial Glycerol Stock
exosome component 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-736s21c1
Sequence:CCGGACCATTCAGCAGACGTTAATTCTCGAGAATTAACGTCTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-683s21c1
Sequence:CCGGATCCATTGGAGATTGTGTTTGCTCGAGCAAACACAATCTCCAATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-822s21c1
Sequence:CCGGACTGGCAGAGAGTTGACATATCTCGAGATATGTCAACTCTCTGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-609s21c1
Sequence:CCGGCAAAGTGACGTTGGGCTTAATCTCGAGATTAAGCCCAACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-569s21c1
Sequence:CCGGCCAATGGGATGGGTGTGATTGCTCGAGCAATCACACCCATCCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-909s1c1
Sequence:CCGGGTGAATTTCTTCCTGGCAGATCTCGAGATCTGCCAGGAAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-637s1c1
Sequence:CCGGGAAAGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-377s1c1
Sequence:CCGGGATCGCTAAATCTGGAGATATCTCGAGATATCTCCAGATTTAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-713s1c1
Sequence:CCGGGAATGGAAGAATATGGGTCAACTCGAGTTGACCCATATTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-519s1c1
Sequence:CCGGGTCGCTAATAAAGACATGGAACTCGAGTTCCATGTCTTTATTAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025513
VALIDATED
EXOSC3 MISSION shRNA shRNA Plasmid DNA
exosome component 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-736s21c1
Sequence:CCGGACCATTCAGCAGACGTTAATTCTCGAGAATTAACGTCTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-683s21c1
Sequence:CCGGATCCATTGGAGATTGTGTTTGCTCGAGCAAACACAATCTCCAATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-822s21c1
Sequence:CCGGACTGGCAGAGAGTTGACATATCTCGAGATATGTCAACTCTCTGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-609s21c1
Sequence:CCGGCAAAGTGACGTTGGGCTTAATCTCGAGATTAAGCCCAACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-569s21c1
Sequence:CCGGCCAATGGGATGGGTGTGATTGCTCGAGCAATCACACCCATCCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-909s1c1
Sequence:CCGGGTGAATTTCTTCCTGGCAGATCTCGAGATCTGCCAGGAAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-637s1c1
Sequence:CCGGGAAAGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-377s1c1
Sequence:CCGGGATCGCTAAATCTGGAGATATCTCGAGATATCTCCAGATTTAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-713s1c1
Sequence:CCGGGAATGGAAGAATATGGGTCAACTCGAGTTGACCCATATTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-519s1c1
Sequence:CCGGGTCGCTAATAAAGACATGGAACTCGAGTTCCATGTCTTTATTAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025513
VALIDATED
EXOSC3 MISSION shRNA Lentiviral Transduction Particles
exosome component 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-736s21c1
Sequence:CCGGACCATTCAGCAGACGTTAATTCTCGAGAATTAACGTCTGCTGAATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-683s21c1
Sequence:CCGGATCCATTGGAGATTGTGTTTGCTCGAGCAAACACAATCTCCAATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-822s21c1
Sequence:CCGGACTGGCAGAGAGTTGACATATCTCGAGATATGTCAACTCTCTGCCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419359    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-609s21c1
Sequence:CCGGCAAAGTGACGTTGGGCTTAATCTCGAGATTAAGCCCAACGTCACTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025513.3-569s21c1
Sequence:CCGGCCAATGGGATGGGTGTGATTGCTCGAGCAATCACACCCATCCCATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098935    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-909s1c1
Sequence:CCGGGTGAATTTCTTCCTGGCAGATCTCGAGATCTGCCAGGAAGAAATTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025513.1-637s1c1
Sequence:CCGGGAAAGCTATTAGCTCCAGATTCTCGAGAATCTGGAGCTAATAGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-377s1c1
Sequence:CCGGGATCGCTAAATCTGGAGATATCTCGAGATATCTCCAGATTTAGCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-713s1c1
Sequence:CCGGGAATGGAAGAATATGGGTCAACTCGAGTTGACCCATATTCTTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025513.1-519s1c1
Sequence:CCGGGTCGCTAATAAAGACATGGAACTCGAGTTCCATGTCTTTATTAGCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks