EMAIL THIS PAGE TO A FRIEND

EXOSC4

exosome component 4

59 Gene Product Result for
Synonyms: RRP41 RRP41A Rrp41p SKI6 Ski6p hRrp41p p12A
UniProtKB ID: Q9NPD3
Gene ID:
Mouse(109075) exosome component 4
Rat(300045) exosome component 4
Zebrafish(393712) exosome component 4
cow(618292) exosome component 4
domestic cat(101100867) exosome component 4
dog(482086) exosome component 4
sheep(101115548) exosome component 4
naked mole-rat(101703302) exosome component 4
domestic guinea pig(100712893) exosome component 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019037 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019037 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019037 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175399 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175399 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175399 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019037 Rosetta Predictions human pricing
NM_001134860 Rosetta Predictions rat pricing
XM_001071925 Rosetta Predictions rat pricing
NM_175399 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019037 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239912 predicted 383
2 SASI_Hs02_00352600 predicted 504
3 SASI_Hs01_00239913 predicted 310
4 SASI_Hs01_00239914 predicted 565
5 SASI_Hs01_00239915 predicted 313
6 SASI_Hs01_00239916 predicted 555
7 SASI_Hs01_00239917 predicted 502
8 SASI_Hs01_00239919 predicted 552
9 SASI_Hs01_00239921 predicted 485
10 SASI_Hs02_00352601 predicted 499
11 SASI_Hs01_00239918 predicted 227
12 SASI_Hs01_00239920 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134860 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258804 predicted 854
2 SASI_Rn02_00258805 predicted 614
3 SASI_Rn02_00258806 predicted 397
4 SASI_Rn02_00258807 predicted 812
5 SASI_Rn02_00258808 predicted 428
6 SASI_Rn02_00258809 predicted 361
7 SASI_Rn02_00258810 predicted 475
8 SASI_Rn02_00258811 predicted 293
9 SASI_Rn02_00258812 predicted 455
10 SASI_Rn02_00258813 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071925 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337010 predicted 858
2 SASI_Rn02_00337011 predicted 616
3 SASI_Rn02_00337012 predicted 400
4 SASI_Rn02_00337013 predicted 804
5 SASI_Rn02_00337014 predicted 435
6 SASI_Rn02_00337015 predicted 360
7 SASI_Rn02_00337016 predicted 479
8 SASI_Rn02_00337017 predicted 294
9 SASI_Rn02_00337018 predicted 463
10 SASI_Rn02_00337019 predicted 307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346251 predicted 858
2 SASI_Mm02_00346252 predicted 972
3 SASI_Mm02_00346253 predicted 874
4 SASI_Mm02_00346254 predicted 954
5 SASI_Mm02_00346255 predicted 582
6 SASI_Mm02_00346256 predicted 882
7 SASI_Mm02_00346257 predicted 927
8 SASI_Mm02_00346258 predicted 351
9 SASI_Mm02_00346259 predicted 539
10 SASI_Mm02_00346260 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019037
VALIDATED
EXOSC4 MISSION shRNA Bacterial Glycerol Stock
exosome component 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-311s1c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-467s1c1
Sequence:CCGGGATATCTATGTGCAGGTGCTACTCGAGTAGCACCTGCACATAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-553s1c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-325s1c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-455s1c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-332s21c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-462s21c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-318s21c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-560s21c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019037
VALIDATED
EXOSC4 MISSION shRNA shRNA Plasmid DNA
exosome component 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-311s1c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-467s1c1
Sequence:CCGGGATATCTATGTGCAGGTGCTACTCGAGTAGCACCTGCACATAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-553s1c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-325s1c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-455s1c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-332s21c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-462s21c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-318s21c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-560s21c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019037
VALIDATED
EXOSC4 MISSION shRNA Lentiviral Transduction Particles
exosome component 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-311s1c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-467s1c1
Sequence:CCGGGATATCTATGTGCAGGTGCTACTCGAGTAGCACCTGCACATAGATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019037.1-553s1c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-325s1c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051364    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_019037.1-455s1c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300994    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-332s21c1
Sequence:CCGGTCAATATAGTTCAGCGACCTTCTCGAGAAGGTCGCTGAACTATATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-462s21c1
Sequence:CCGGCGCTCCCAGATTGATATCTATCTCGAGATAGATATCAATCTGGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-318s21c1
Sequence:CCGGGCCCTAGTGAACTGTCAATATCTCGAGATATTGACAGTTCACTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019037.2-560s21c1
Sequence:CCGGGATACCCATGAGAGACTTTGTCTCGAGACAAAGTCTCTCATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175399
VALIDATED
EXOSC4 MISSION shRNA Bacterial Glycerol Stock
exosome component 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175399.2-1003s1c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-448s1c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-373s1c1
Sequence:CCGGAGACCGGAAGTCTTGTGAGATCTCGAGATCTCACAAGACTTCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-196s1c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-319s1c1
Sequence:CCGGTCAGTACAGTTCAGCCACCTTCTCGAGAAGGTGGCTGAACTGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-678s21c1
Sequence:CCGGCCAGATCGCACTGCTTGAGATCTCGAGATCTCAAGCAGTGCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-447s21c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-545s21c1
Sequence:CCGGGGATACCTATGCGGGACTTTGCTCGAGCAAAGTCCCGCATAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175399.4-195s21c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000354153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175399.4-1002s21c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175399
VALIDATED
EXOSC4 MISSION shRNA shRNA Plasmid DNA
exosome component 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175399.2-1003s1c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-448s1c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-373s1c1
Sequence:CCGGAGACCGGAAGTCTTGTGAGATCTCGAGATCTCACAAGACTTCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-196s1c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-319s1c1
Sequence:CCGGTCAGTACAGTTCAGCCACCTTCTCGAGAAGGTGGCTGAACTGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-678s21c1
Sequence:CCGGCCAGATCGCACTGCTTGAGATCTCGAGATCTCAAGCAGTGCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-447s21c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-545s21c1
Sequence:CCGGGGATACCTATGCGGGACTTTGCTCGAGCAAAGTCCCGCATAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175399.4-195s21c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000354153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175399.4-1002s21c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175399
VALIDATED
EXOSC4 MISSION shRNA Lentiviral Transduction Particles
exosome component 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111350    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175399.2-1003s1c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-448s1c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-373s1c1
Sequence:CCGGAGACCGGAAGTCTTGTGAGATCTCGAGATCTCACAAGACTTCCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-196s1c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175399.2-319s1c1
Sequence:CCGGTCAGTACAGTTCAGCCACCTTCTCGAGAAGGTGGCTGAACTGTACTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-678s21c1
Sequence:CCGGCCAGATCGCACTGCTTGAGATCTCGAGATCTCAAGCAGTGCGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-447s21c1
Sequence:CCGGCCGCTCTCAGATCGACATCTACTCGAGTAGATGTCGATCTGAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175399.4-545s21c1
Sequence:CCGGGGATACCTATGCGGGACTTTGCTCGAGCAAAGTCCCGCATAGGTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354152    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175399.4-195s21c1
Sequence:CCGGGCAGGCCGATGGCTCGGCTTACTCGAGTAAGCCGAGCCATCGGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000354153    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175399.4-1002s21c1
Sequence:CCGGCCAGATATTAGGGTCCGCAAACTCGAGTTTGCGGACCCTAATATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks