EMAIL THIS PAGE TO A FRIEND

EXOSC5

exosome component 5

62 Gene Product Result for
Synonyms: RRP41B RRP46 Rrp46p hRrp46p p12B
UniProtKB ID: Q9NQT4, Q32Q81, Q8NG16, Q96I89
Gene ID:
Mouse(27998) exosome component 5
Rat(308441) exosome component 5
domestic guinea pig(100714897) exosome component 5
naked mole-rat(101705555) exosome component 5
sheep(101123655) exosome component 5
Zebrafish(751632) exosome component 5
chicken(100858931) exosome component 5
cow(100138962) exosome component 5
domestic cat(101087437) exosome component 5
dog(611350) exosome component 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138586 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138586 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138586 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020158 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020158 Rosetta Predictions human pricing
NM_001107493 Rosetta Predictions rat pricing
XM_218343 Rosetta Predictions rat pricing
NM_138586 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012291 predicted 744
2 SASI_Hs01_00012293 predicted 247
3 SASI_Hs01_00012294 predicted 669
4 SASI_Hs01_00012295 predicted 696
5 SASI_Hs01_00012297 predicted 682
6 SASI_Hs01_00012298 predicted 243
7 SASI_Hs01_00012299 predicted 711
8 SASI_Hs01_00012300 predicted 520
9 SASI_Hs02_00353057 predicted 243
10 SASI_Hs02_00353058 predicted 712
11 SASI_Hs01_00012292 predicted 618
12 SASI_Hs01_00012296 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107493 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229375 predicted 472
2 SASI_Rn02_00229376 predicted 471
3 SASI_Rn02_00229377 predicted 365
4 SASI_Rn02_00229378 predicted 460
5 SASI_Rn02_00229379 predicted 372
6 SASI_Rn02_00229380 predicted 573
7 SASI_Rn02_00229381 predicted 469
8 SASI_Rn02_00229382 predicted 409
9 SASI_Rn02_00229383 predicted 563
10 SASI_Rn02_00229384 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218343 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156470 predicted 728
2 SASI_Rn01_00156471 predicted 382
3 SASI_Rn01_00156472 predicted 288
4 SASI_Rn01_00156473 predicted 661
5 SASI_Rn01_00156474 predicted 718
6 SASI_Rn01_00156475 predicted 280
7 SASI_Rn01_00156476 predicted 371
8 SASI_Rn01_00156477 predicted 387
9 SASI_Rn01_00156478 predicted 281
10 SASI_Rn01_00156479 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138586 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187482 predicted 733
2 SASI_Mm01_00187483 predicted 638
3 SASI_Mm01_00187484 predicted 720
4 SASI_Mm01_00187485 predicted 262
5 SASI_Mm01_00187486 predicted 483
6 SASI_Mm01_00187487 predicted 266
7 SASI_Mm02_00339642 predicted 473
8 SASI_Mm01_00187488 predicted 735
9 SASI_Mm01_00187489 predicted 607
10 SASI_Mm01_00187490 predicted 296
11 SASI_Mm01_00187491 predicted 620
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138586
VALIDATED
EXOSC5 MISSION shRNA Bacterial Glycerol Stock
exosome component 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138586.2-852s21c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-473s21c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-360s21c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-215s21c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-474s1c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-645s1c1
Sequence:CCGGGCTGCTCATGTCCACCACCAACTCGAGTTGGTGGTGGACATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-216s1c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-361s1c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138586.1-853s1c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138586
VALIDATED
EXOSC5 MISSION shRNA shRNA Plasmid DNA
exosome component 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138586.2-852s21c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-473s21c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-360s21c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-215s21c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-474s1c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-645s1c1
Sequence:CCGGGCTGCTCATGTCCACCACCAACTCGAGTTGGTGGTGGACATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-216s1c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-361s1c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138586.1-853s1c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138586
VALIDATED
EXOSC5 MISSION shRNA Lentiviral Transduction Particles
exosome component 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332525    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138586.2-852s21c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-473s21c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-360s21c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138586.2-215s21c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-474s1c1
Sequence:CCGGGAACGCTGCTTGCATGGCATTCTCGAGAATGCCATGCAAGCAGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_138586.1-645s1c1
Sequence:CCGGGCTGCTCATGTCCACCACCAACTCGAGTTGGTGGTGGACATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-216s1c1
Sequence:CCGGTCAAGGTGATACCTCTGTCCTCTCGAGAGGACAGAGGTATCACCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138586.1-361s1c1
Sequence:CCGGCTGGTCAGGAATACCTGTGAACTCGAGTTCACAGGTATTCCTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111380    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138586.1-853s1c1
Sequence:CCGGGCCTCTGTCTGTGCCCATGTACTCGAGTACATGGGCACAGACAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020158
VALIDATED
EXOSC5 MISSION shRNA Bacterial Glycerol Stock
exosome component 5
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-33s21c1
Sequence:CCGGGAGACGCATACTGACGCCAAACTCGAGTTTGGCGTCAGTATGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-213s21c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-674s21c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020158.3-836s21c1
Sequence:CCGGTTGAGCCTGCAGCTCTGTAACCTCGAGGTTACAGAGCTGCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-110s21c1
Sequence:CCGGGCACTTTGCCTGCGAACAGAACTCGAGTTCTGTTCGCAGGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-791s1c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-330s1c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-368s1c1
Sequence:CCGGCGAAGTGATCCTGAGGCCGAACTCGAGTTCGGCCTCAGGATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-799s1c1
Sequence:CCGGTCTTCCGTTTCTACCGGGAATCTCGAGATTCCCGGTAGAAACGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020158
VALIDATED
EXOSC5 MISSION shRNA shRNA Plasmid DNA
exosome component 5
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-33s21c1
Sequence:CCGGGAGACGCATACTGACGCCAAACTCGAGTTTGGCGTCAGTATGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-213s21c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-674s21c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020158.3-836s21c1
Sequence:CCGGTTGAGCCTGCAGCTCTGTAACCTCGAGGTTACAGAGCTGCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-110s21c1
Sequence:CCGGGCACTTTGCCTGCGAACAGAACTCGAGTTCTGTTCGCAGGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-791s1c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-330s1c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-368s1c1
Sequence:CCGGCGAAGTGATCCTGAGGCCGAACTCGAGTTCGGCCTCAGGATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-799s1c1
Sequence:CCGGTCTTCCGTTTCTACCGGGAATCTCGAGATTCCCGGTAGAAACGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020158
VALIDATED
EXOSC5 MISSION shRNA Lentiviral Transduction Particles
exosome component 5
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-33s21c1
Sequence:CCGGGAGACGCATACTGACGCCAAACTCGAGTTTGGCGTCAGTATGCGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286813    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-213s21c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_020158.3-674s21c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020158.3-836s21c1
Sequence:CCGGTTGAGCCTGCAGCTCTGTAACCTCGAGGTTACAGAGCTGCAGGCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020158.3-110s21c1
Sequence:CCGGGCACTTTGCCTGCGAACAGAACTCGAGTTCTGTTCGCAGGCAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-791s1c1
Sequence:CCGGGCAACACGTCTTCCGTTTCTACTCGAGTAGAAACGGAAGACGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_020158.2-330s1c1
Sequence:CCGGGTGAAGGTCAGCAAAGAGATTCTCGAGAATCTCTTTGCTGACCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050622    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-368s1c1
Sequence:CCGGCGAAGTGATCCTGAGGCCGAACTCGAGTTCGGCCTCAGGATCACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020158.2-799s1c1
Sequence:CCGGTCTTCCGTTTCTACCGGGAATCTCGAGATTCCCGGTAGAAACGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks