EMAIL THIS PAGE TO A FRIEND

EXOSC6

exosome component 6

47 Gene Product Result for
Synonyms: EAP4 MTR3 Mtr3p hMtr3p p11
UniProtKB ID: Q5RKV6
Gene ID:
Human(118460) Summary: This gene product constitutes one of the subunits of the multisubunit particle called exosome, which mediates mRNA degradation. The composition of human exosome is similar to its yeast counterpart. This protein is homologous to the yeast Mtr3 protein. Its exact function is not known, however, it has been shown using a cell-free RNA decay system that the exosome is required for rapid degradation of unstable mRNAs containing AU-rich elements (AREs), but not for poly(A) shortening. The exosome does not recognize ARE-containing mRNAs on its own, but requires ARE-binding proteins that could interact with the exosome and recruit it to unstable mRNAs, thereby promoting their rapid degradation. [provided by RefSeq, Jul 2008]
Mouse(72544) exosome component 6
Rat(307850) exosome component 6
Zebrafish(326786) exosome component 6
cow(100126247) exosome component 6
domestic cat(101095147) exosome component 6
dog(489713) exosome component 6
sheep(101115396) exosome component 6
naked mole-rat(101718639) exosome component 6
domestic guinea pig(101788453) exosome component 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV41086 Anti-EXOSC6 (AB1) antibody produced in rabbit affinity isolated antibody bovine, rat, zebrafish, canine, human, mouse
western blot pricing
AV41087 Anti-EXOSC6 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, rat, mouse, human, bovine
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028274 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028274 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028274 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_058219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_058219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_058219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_058219 Rosetta Predictions human pricing
XM_001077520 Rosetta Predictions rat pricing
XM_226471 Rosetta Predictions rat pricing
NM_028274 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058219 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244294 predicted 713
2 SASI_Hs01_00244295 predicted 107
3 SASI_Hs01_00244296 predicted 536
4 SASI_Hs01_00244297 predicted 926
5 SASI_Hs01_00244298 predicted 883
6 SASI_Hs01_00244299 predicted 908
7 SASI_Hs01_00244300 predicted 49
8 SASI_Hs02_00362137 predicted 922
9 SASI_Hs01_00244301 predicted 925
10 SASI_Hs01_00244303 predicted 1018
11 SASI_Hs01_00244302 predicted 429
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077520 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357385 predicted 487
2 SASI_Rn02_00357386 predicted 954
3 SASI_Rn02_00357387 predicted 577
4 SASI_Rn02_00357388 predicted 1182
5 SASI_Rn02_00357389 predicted 1097
6 SASI_Rn02_00357390 predicted 721
7 SASI_Rn02_00357391 predicted 978
8 SASI_Rn02_00357392 predicted 491
9 SASI_Rn02_00357393 predicted 953
10 SASI_Rn02_00357394 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226471 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383605 predicted 485
2 SASI_Rn02_00383606 predicted 954
3 SASI_Rn02_00383607 predicted 581
4 SASI_Rn02_00383608 predicted 1183
5 SASI_Rn02_00383609 predicted 1092
6 SASI_Rn02_00383610 predicted 721
7 SASI_Rn02_00383611 predicted 977
8 SASI_Rn02_00383612 predicted 489
9 SASI_Rn02_00383613 predicted 956
10 SASI_Rn02_00383614 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028274 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200900 predicted 669
2 SASI_Mm01_00200901 predicted 671
3 SASI_Mm01_00200902 predicted 1040
4 SASI_Mm01_00200903 predicted 1031
5 SASI_Mm01_00200904 predicted 994
6 SASI_Mm01_00200905 predicted 996
7 SASI_Mm01_00200906 predicted 552
8 SASI_Mm01_00200907 predicted 732
9 SASI_Mm01_00200908 predicted 789
10 SASI_Mm01_00200909 predicted 1023
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028274
EXOSC6 MISSION shRNA Bacterial Glycerol Stock
exosome component 6
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000111420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028274.1-1026s1c1
Sequence:CCGGCGTTGGAAACACGATCCAGTTCTCGAGAACTGGATCGTGTTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-733s1c1
Sequence:CCGGCAGACTGAGAGTTGGACCGATCTCGAGATCGGTCCAACTCTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-793s1c1
Sequence:CCGGCCAGTGCTGCAGCAGTGTTTGCTCGAGCAAACACTGCTGCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-678s1c1
Sequence:CCGGCCTCATGCCTGTGCTCAATCACTCGAGTGATTGAGCACAGGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028274
EXOSC6 MISSION shRNA shRNA Plasmid DNA
exosome component 6
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000111420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028274.1-1026s1c1
Sequence:CCGGCGTTGGAAACACGATCCAGTTCTCGAGAACTGGATCGTGTTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-733s1c1
Sequence:CCGGCAGACTGAGAGTTGGACCGATCTCGAGATCGGTCCAACTCTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-793s1c1
Sequence:CCGGCCAGTGCTGCAGCAGTGTTTGCTCGAGCAAACACTGCTGCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-678s1c1
Sequence:CCGGCCTCATGCCTGTGCTCAATCACTCGAGTGATTGAGCACAGGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028274
EXOSC6 MISSION shRNA Lentiviral Transduction Particles
exosome component 6
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000111420    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028274.1-1026s1c1
Sequence:CCGGCGTTGGAAACACGATCCAGTTCTCGAGAACTGGATCGTGTTTCCAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-733s1c1
Sequence:CCGGCAGACTGAGAGTTGGACCGATCTCGAGATCGGTCCAACTCTCAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-793s1c1
Sequence:CCGGCCAGTGCTGCAGCAGTGTTTGCTCGAGCAAACACTGCTGCAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028274.1-678s1c1
Sequence:CCGGCCTCATGCCTGTGCTCAATCACTCGAGTGATTGAGCACAGGCATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_058219
EXOSC6 MISSION shRNA Bacterial Glycerol Stock
exosome component 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1137s1c1
Sequence:CCGGCTCAAACTCCTAGCCTTGATTCTCGAGAATCAAGGCTAGGAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1562s1c1
Sequence:CCGGGCACAGAATGTACGGTGATATCTCGAGATATCACCGTACATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1087s1c1
Sequence:CCGGCCTGAAATTACCTGGACCTTTCTCGAGAAAGGTCCAGGTAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1537s1c1
Sequence:CCGGGCCCAGCTGAGTAAATTTCTTCTCGAGAAGAAATTTACTCAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1086s1c1
Sequence:CCGGCCCTGAAATTACCTGGACCTTCTCGAGAAGGTCCAGGTAATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1204s1c1
Sequence:CCGGGCAACCACACCTGGCTAATTTCTCGAGAAATTAGCCAGGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1016s1c1
Sequence:CCGGGCAGGGACTACTTGGAATGATCTCGAGATCATTCCAAGTAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-961s21c1
Sequence:CCGGTGATATGACTGTGGTTGGACTCTCGAGAGTCCAACCACAGTCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-1120s21c1
Sequence:CCGGGGGTTTCTTTCTGCAGTCTCACTCGAGTGAGACTGCAGAAAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_058219
EXOSC6 MISSION shRNA shRNA Plasmid DNA
exosome component 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1137s1c1
Sequence:CCGGCTCAAACTCCTAGCCTTGATTCTCGAGAATCAAGGCTAGGAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1562s1c1
Sequence:CCGGGCACAGAATGTACGGTGATATCTCGAGATATCACCGTACATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1087s1c1
Sequence:CCGGCCTGAAATTACCTGGACCTTTCTCGAGAAAGGTCCAGGTAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1537s1c1
Sequence:CCGGGCCCAGCTGAGTAAATTTCTTCTCGAGAAGAAATTTACTCAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1086s1c1
Sequence:CCGGCCCTGAAATTACCTGGACCTTCTCGAGAAGGTCCAGGTAATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1204s1c1
Sequence:CCGGGCAACCACACCTGGCTAATTTCTCGAGAAATTAGCCAGGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1016s1c1
Sequence:CCGGGCAGGGACTACTTGGAATGATCTCGAGATCATTCCAAGTAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-961s21c1
Sequence:CCGGTGATATGACTGTGGTTGGACTCTCGAGAGTCCAACCACAGTCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-1120s21c1
Sequence:CCGGGGGTTTCTTTCTGCAGTCTCACTCGAGTGAGACTGCAGAAAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_058219
EXOSC6 MISSION shRNA Lentiviral Transduction Particles
exosome component 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155982    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1137s1c1
Sequence:CCGGCTCAAACTCCTAGCCTTGATTCTCGAGAATCAAGGCTAGGAGTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154536    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1562s1c1
Sequence:CCGGGCACAGAATGTACGGTGATATCTCGAGATATCACCGTACATTCTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154335    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1087s1c1
Sequence:CCGGCCTGAAATTACCTGGACCTTTCTCGAGAAAGGTCCAGGTAATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154485    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1537s1c1
Sequence:CCGGGCCCAGCTGAGTAAATTTCTTCTCGAGAAGAAATTTACTCAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158322    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1086s1c1
Sequence:CCGGCCCTGAAATTACCTGGACCTTCTCGAGAAGGTCCAGGTAATTTCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156872    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_058219.2-1204s1c1
Sequence:CCGGGCAACCACACCTGGCTAATTTCTCGAGAAATTAGCCAGGTGTGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157038    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_058219.2-1016s1c1
Sequence:CCGGGCAGGGACTACTTGGAATGATCTCGAGATCATTCCAAGTAGTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-961s21c1
Sequence:CCGGTGATATGACTGTGGTTGGACTCTCGAGAGTCCAACCACAGTCATATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429864    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_058219.2-1120s21c1
Sequence:CCGGGGGTTTCTTTCTGCAGTCTCACTCGAGTGAGACTGCAGAAAGAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks