EMAIL THIS PAGE TO A FRIEND

EXOSC7

exosome component 7

102 Gene Product Result for
Synonyms: EAP1 RRP42 Rrp42p hRrp42p p8
UniProtKB ID: Q15024, Q96E72
Gene ID:
Mouse(66446) exosome component 7
Rat(316098) exosome component 7
naked mole-rat(101703631) exosome component 7
sheep(101120279) exosome component 7
Zebrafish(550247) exosome component 7
chicken(420704) exosome component 7
dog(476654) exosome component 7
cow(100847343) exosome component 7
domestic cat(101081873) exosome component 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200456 Anti-EXOSC7 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
immunofluorescence, immunoprecipitation, western blot pricing
SAB4200457 Anti-EXOSC7 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody human
western blot pricing
SAB1407167 Anti-EXOSC7 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV40796 Anti-EXOSC7 antibody produced in rabbit IgG fraction of antiserum canine, horse, mouse, rat, bovine, human, zebrafish, rabbit, guinea pig
immunohistochemistry, western blot pricing
SAB2100732 Anti-EXOSC7 antibody produced in rabbit affinity isolated antibody rabbit, canine, bovine, mouse, rat, guinea pig, horse, human,
western blot pricing
HPA057980 Anti-EXOSC7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA036182 Anti-EXOSC7 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
SAB4100454 Monoclonal Anti-EXOSC7 antibody produced in mouse clone EXOSC7-A391, culture supernatant human
western blot pricing
SAB1403122 Monoclonal Anti-EXOSC7, (C-terminal) antibody produced in mouse clone 2F10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015004 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015004 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015004 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081188 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081188 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081188 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015004 Rosetta Predictions human pricing
NR_023353 Rosetta Predictions human pricing
XM_001078932 Rosetta Predictions rat pricing
XM_236745 Rosetta Predictions rat pricing
NM_001081188 Rosetta Predictions mouse pricing
XM_284543 Rosetta Predictions mouse pricing
XM_902988 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015004 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103138 predicted 719
2 SASI_Hs01_00103139 predicted 384
3 SASI_Hs01_00103140 predicted 379
4 SASI_Hs01_00103141 predicted 319
5 SASI_Hs01_00103142 predicted 723
6 SASI_Hs01_00103143 predicted 775
7 SASI_Hs01_00103145 predicted 771
8 SASI_Hs01_00103146 predicted 558
9 SASI_Hs02_00346774 predicted 801
10 SASI_Hs02_00346775 predicted 801
11 SASI_Hs01_00103137 predicted 631
12 SASI_Hs01_00103144 predicted 392
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023353 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381782 predicted 820
2 SASI_Hs02_00381783 predicted 887
3 SASI_Hs02_00381784 predicted 722
4 SASI_Hs02_00381785 predicted 970
5 SASI_Hs02_00381786 predicted 522
6 SASI_Hs02_00381787 predicted 873
7 SASI_Hs02_00381788 predicted 618
8 SASI_Hs02_00381789 predicted 534
9 SASI_Hs02_00381790 predicted 580
10 SASI_Hs02_00381791 predicted 818
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078932 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362540 predicted 671
2 SASI_Rn02_00362541 predicted 644
3 SASI_Rn02_00362542 predicted 509
4 SASI_Rn02_00362543 predicted 333
5 SASI_Rn02_00362544 predicted 554
6 SASI_Rn02_00362545 predicted 256
7 SASI_Rn02_00362546 predicted 543
8 SASI_Rn02_00362547 predicted 763
9 SASI_Rn02_00362548 predicted 340
10 SASI_Rn02_00362549 predicted 747
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236745 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390390 predicted 674
2 SASI_Rn02_00390391 predicted 638
3 SASI_Rn02_00390392 predicted 508
4 SASI_Rn02_00390393 predicted 331
5 SASI_Rn02_00390394 predicted 561
6 SASI_Rn02_00390395 predicted 255
7 SASI_Rn02_00390396 predicted 539
8 SASI_Rn02_00390397 predicted 761
9 SASI_Rn02_00390398 predicted 344
10 SASI_Rn02_00390399 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081188 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296051 predicted 201
2 SASI_Mm02_00296052 predicted 526
3 SASI_Mm02_00296053 predicted 418
4 SASI_Mm02_00296054 predicted 660
5 SASI_Mm02_00296055 predicted 734
6 SASI_Mm02_00296056 predicted 246
7 SASI_Mm02_00296057 predicted 201
8 SASI_Mm02_00296058 predicted 192
9 SASI_Mm02_00296059 predicted 478
10 SASI_Mm02_00296060 predicted 386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_284543 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00255795 predicted 533
2 SASI_Mm01_00255796 predicted 422
3 SASI_Mm01_00255797 predicted 659
4 SASI_Mm01_00255798 predicted 732
5 SASI_Mm01_00255799 predicted 259
6 SASI_Mm01_00255800 predicted 273
7 SASI_Mm01_00255801 predicted 487
8 SASI_Mm01_00255802 predicted 389
9 SASI_Mm01_00255803 predicted 768
10 SASI_Mm01_00255804 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_902988 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00221804 predicted 118
2 SASI_Mm01_00221805 predicted 122
3 SASI_Mm01_00221806 predicted 138
4 SASI_Mm01_00221807 predicted 114
5 SASI_Mm01_00221808 predicted 241
6 SASI_Mm01_00221809 predicted 253
7 SASI_Mm01_00221810 predicted 227
8 SASI_Mm01_00221811 predicted 81
9 SASI_Mm01_00221812 predicted 47
10 SASI_Mm01_00221813 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015004
VALIDATED
EXOSC7 MISSION shRNA Bacterial Glycerol Stock
exosome component 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-119s21c1
Sequence:CCGGGGACTACCGATGTGTCGAAGTCTCGAGACTTCGACACATCGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-657s21c1
Sequence:CCGGCATGTGGTGGATGCTACTCTTCTCGAGAAGAGTAGCATCCACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-58s21c1
Sequence:CCGGAGAAGGTGTACATCGTGCATGCTCGAGCATGCACGATGTACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-775s21c1
Sequence:CCGGCAGAGAGCATCTTCGAGATGACTCGAGTCATCTCGAAGATGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-389s21c1
Sequence:CCGGCTTAAAGACCCTCTGCATTAGCTCGAGCTAATGCAGAGGGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-418s21c1
Sequence:CCGGAGCACTGCTGGGTTCTCTATGCTCGAGCATAGAGAACCCAGCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-426s1c1
Sequence:CCGGGCTTCTGGAATGTGGTGGAAACTCGAGTTTCCACCACATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-573s1c1
Sequence:CCGGCATACGACTAAGTGTGGAGAACTCGAGTTCTCCACACTTAGTCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-316s1c1
Sequence:CCGGGAGATCGCTAACACCCTCTATCTCGAGATAGAGGGTGTTAGCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-817s1c1
Sequence:CCGGCAGAGTGTTCTGCACAAGGAACTCGAGTTCCTTGTGCAGAACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015004
VALIDATED
EXOSC7 MISSION shRNA shRNA Plasmid DNA
exosome component 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-119s21c1
Sequence:CCGGGGACTACCGATGTGTCGAAGTCTCGAGACTTCGACACATCGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-657s21c1
Sequence:CCGGCATGTGGTGGATGCTACTCTTCTCGAGAAGAGTAGCATCCACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-58s21c1
Sequence:CCGGAGAAGGTGTACATCGTGCATGCTCGAGCATGCACGATGTACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-775s21c1
Sequence:CCGGCAGAGAGCATCTTCGAGATGACTCGAGTCATCTCGAAGATGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-389s21c1
Sequence:CCGGCTTAAAGACCCTCTGCATTAGCTCGAGCTAATGCAGAGGGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-418s21c1
Sequence:CCGGAGCACTGCTGGGTTCTCTATGCTCGAGCATAGAGAACCCAGCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-426s1c1
Sequence:CCGGGCTTCTGGAATGTGGTGGAAACTCGAGTTTCCACCACATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-573s1c1
Sequence:CCGGCATACGACTAAGTGTGGAGAACTCGAGTTCTCCACACTTAGTCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-316s1c1
Sequence:CCGGGAGATCGCTAACACCCTCTATCTCGAGATAGAGGGTGTTAGCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-817s1c1
Sequence:CCGGCAGAGTGTTCTGCACAAGGAACTCGAGTTCCTTGTGCAGAACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015004
VALIDATED
EXOSC7 MISSION shRNA Lentiviral Transduction Particles
exosome component 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447460    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-119s21c1
Sequence:CCGGGGACTACCGATGTGTCGAAGTCTCGAGACTTCGACACATCGGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-657s21c1
Sequence:CCGGCATGTGGTGGATGCTACTCTTCTCGAGAAGAGTAGCATCCACCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-58s21c1
Sequence:CCGGAGAAGGTGTACATCGTGCATGCTCGAGCATGCACGATGTACACCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-775s21c1
Sequence:CCGGCAGAGAGCATCTTCGAGATGACTCGAGTCATCTCGAAGATGCTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-389s21c1
Sequence:CCGGCTTAAAGACCCTCTGCATTAGCTCGAGCTAATGCAGAGGGTCTTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015004.3-418s21c1
Sequence:CCGGAGCACTGCTGGGTTCTCTATGCTCGAGCATAGAGAACCCAGCAGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-426s1c1
Sequence:CCGGGCTTCTGGAATGTGGTGGAAACTCGAGTTTCCACCACATTCCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051070    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-573s1c1
Sequence:CCGGCATACGACTAAGTGTGGAGAACTCGAGTTCTCCACACTTAGTCGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-316s1c1
Sequence:CCGGGAGATCGCTAACACCCTCTATCTCGAGATAGAGGGTGTTAGCGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015004.2-817s1c1
Sequence:CCGGCAGAGTGTTCTGCACAAGGAACTCGAGTTCCTTGTGCAGAACACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081188
VALIDATED
EXOSC7 MISSION shRNA Bacterial Glycerol Stock
exosome component 7
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-472s21c1
Sequence:CCGGGGAATTTGTTTGATGCTATTTCTCGAGAAATAGCATCAAACAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-423s21c1
Sequence:CCGGGAGCACTGCTGGGTTCTATATCTCGAGATATAGAACCCAGCAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-353s21c1
Sequence:CCGGTAACACCCTCTACCGGATATTCTCGAGAATATCCGGTAGAGGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-604s21c1
Sequence:CCGGTCCGACTGAGTGTAGAGAATGCTCGAGCATTCTCTACACTCAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000258150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-576s21c1
Sequence:CCGGGAGCTGTCTGACGATCCTTATCTCGAGATAAGGATCGTCAGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081188
VALIDATED
EXOSC7 MISSION shRNA shRNA Plasmid DNA
exosome component 7
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-472s21c1
Sequence:CCGGGGAATTTGTTTGATGCTATTTCTCGAGAAATAGCATCAAACAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-423s21c1
Sequence:CCGGGAGCACTGCTGGGTTCTATATCTCGAGATATAGAACCCAGCAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-353s21c1
Sequence:CCGGTAACACCCTCTACCGGATATTCTCGAGAATATCCGGTAGAGGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-604s21c1
Sequence:CCGGTCCGACTGAGTGTAGAGAATGCTCGAGCATTCTCTACACTCAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000258150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-576s21c1
Sequence:CCGGGAGCTGTCTGACGATCCTTATCTCGAGATAAGGATCGTCAGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081188
VALIDATED
EXOSC7 MISSION shRNA Lentiviral Transduction Particles
exosome component 7
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-472s21c1
Sequence:CCGGGGAATTTGTTTGATGCTATTTCTCGAGAAATAGCATCAAACAAATTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-423s21c1
Sequence:CCGGGAGCACTGCTGGGTTCTATATCTCGAGATATAGAACCCAGCAGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251313    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-353s21c1
Sequence:CCGGTAACACCCTCTACCGGATATTCTCGAGAATATCCGGTAGAGGGTGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-604s21c1
Sequence:CCGGTCCGACTGAGTGTAGAGAATGCTCGAGCATTCTCTACACTCAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000258150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081188.1-576s21c1
Sequence:CCGGGAGCTGTCTGACGATCCTTATCTCGAGATAAGGATCGTCAGACAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks