EMAIL THIS PAGE TO A FRIEND

EXOSC8

exosome component 8

76 Gene Product Result for
Synonyms: CIP3 EAP2 OIP2 RP11-421P11.3 RRP43 Rrp43p bA421P11.3 p9
UniProtKB ID: Q96B26, O43480, Q5TBA5
Gene ID:
Human(11340) Summary: This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
Mouse(69639) exosome component 8
Rat(295050) exosome component 8
Zebrafish(323016) exosome component 8
chicken(100858560) exosome component 8
domestic cat(101088543) exosome component 8
cow(532080) exosome component 8
dog(477300) exosome component 8
sheep(101104834) exosome component 8
naked mole-rat(101714894) exosome component 8
domestic guinea pig(100727612) exosome component 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027148 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027148 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027148 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181503 Rosetta Predictions human pricing
NM_001106432 Rosetta Predictions rat pricing
NM_027148 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103307 predicted 537
2 SASI_Hs01_00103308 predicted 686
3 SASI_Hs01_00103309 predicted 338
4 SASI_Hs01_00103311 predicted 419
5 SASI_Hs01_00103312 predicted 668
6 SASI_Hs01_00103313 predicted 508
7 SASI_Hs01_00103314 predicted 211
8 SASI_Hs02_00370121 predicted 211
9 SASI_Hs02_00370122 predicted 615
10 SASI_Hs02_00370123 predicted 616
11 SASI_Hs01_00103310 predicted 560
12 SASI_Hs01_00103315 predicted 242
13 SASI_Hs01_00103316 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106432 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218908 predicted 1070
2 SASI_Rn02_00218909 predicted 905
3 SASI_Rn02_00218910 predicted 938
4 SASI_Rn02_00218911 predicted 1105
5 SASI_Rn02_00218912 predicted 1073
6 SASI_Rn02_00218913 predicted 901
7 SASI_Rn02_00218914 predicted 869
8 SASI_Rn02_00218915 predicted 867
9 SASI_Rn02_00218916 predicted 877
10 SASI_Rn02_00218917 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027148 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00084575 predicted 673
2 SASI_Mm01_00084576 predicted 890
3 SASI_Mm01_00084577 predicted 717
4 SASI_Mm01_00084578 predicted 471
5 SASI_Mm02_00331657 predicted 859
6 SASI_Mm01_00084580 predicted 595
7 SASI_Mm01_00084581 predicted 846
8 SASI_Mm01_00084582 predicted 832
9 SASI_Mm01_00084583 predicted 684
10 SASI_Mm01_00084584 predicted 724
11 SASI_Mm01_00084579 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181503
VALIDATED
EXOSC8 MISSION shRNA Bacterial Glycerol Stock
exosome component 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-57s1c1
Sequence:CCGGCTGGAGTATTACAGGAGATTTCTCGAGAAATCTCCTGTAATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-477s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-344s1c1
Sequence:CCGGCCAATTCATTGCAGATGTCATCTCGAGATGACATCTGCAATGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-760s1c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-171s1c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181503.2-999s21c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-410s21c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-913s21c1
Sequence:CCGGTCTGGCAACAGGAACCTTAACCTCGAGGTTAAGGTTCCTGTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-758s21c1
Sequence:CCGGTTGCCTGAAGTTACTATAAATCTCGAGATTTATAGTAACTTCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-716s21c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181503
VALIDATED
EXOSC8 MISSION shRNA shRNA Plasmid DNA
exosome component 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-57s1c1
Sequence:CCGGCTGGAGTATTACAGGAGATTTCTCGAGAAATCTCCTGTAATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-477s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-344s1c1
Sequence:CCGGCCAATTCATTGCAGATGTCATCTCGAGATGACATCTGCAATGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-760s1c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-171s1c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181503.2-999s21c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-410s21c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-913s21c1
Sequence:CCGGTCTGGCAACAGGAACCTTAACCTCGAGGTTAAGGTTCCTGTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-758s21c1
Sequence:CCGGTTGCCTGAAGTTACTATAAATCTCGAGATTTATAGTAACTTCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-716s21c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181503
VALIDATED
EXOSC8 MISSION shRNA Lentiviral Transduction Particles
exosome component 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-57s1c1
Sequence:CCGGCTGGAGTATTACAGGAGATTTCTCGAGAAATCTCCTGTAATACTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-477s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-344s1c1
Sequence:CCGGCCAATTCATTGCAGATGTCATCTCGAGATGACATCTGCAATGAATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-760s1c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_181503.1-171s1c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181503.2-999s21c1
Sequence:CCGGGAGCTAAACTTCAGGACTGTACTCGAGTACAGTCCTGAAGTTTAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-410s21c1
Sequence:CCGGGCTTTAGTGAAGTTGGGAAATCTCGAGATTTCCCAACTTCACTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-913s21c1
Sequence:CCGGTCTGGCAACAGGAACCTTAACCTCGAGGTTAAGGTTCCTGTTGCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-758s21c1
Sequence:CCGGTTGCCTGAAGTTACTATAAATCTCGAGATTTATAGTAACTTCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_181503.2-716s21c1
Sequence:CCGGGCCTGCACATTTGCTTTGCTACTCGAGTAGCAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027148
VALIDATED
EXOSC8 MISSION shRNA Bacterial Glycerol Stock
exosome component 8
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000104065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-398s1c1
Sequence:CCGGCGCTGGAGTATTACAGGAGATCTCGAGATCTCCTGTAATACTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-964s1c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-537s1c1
Sequence:CCGGCACGGTCATTTGTGGCGTTAACTCGAGTTAACGCCACAAATGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-536s1c1
Sequence:CCGGCCACGGTCATTTGTGGCGTTACTCGAGTAACGCCACAAATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-820s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGTTACTCGAGTAACAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-765s21c1
Sequence:CCGGTAGACTACGATGGGAACATTTCTCGAGAAATGTTCCCATCGTAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.3-509s21c1
Sequence:CCGGACGGTCATTTGTGGCGTTAAACTCGAGTTTAACGCCACAAATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-864s21c1
Sequence:CCGGCTTTAGCCGAAGTCAATTTAACTCGAGTTAAATTGACTTCGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-892s21c1
Sequence:CCGGGCTTTAGCCGAAGTCAATTTACTCGAGTAAATTGACTTCGGCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-756s21c1
Sequence:CCGGCAAGCTTGCTTGGGTTCTATACTCGAGTATAGAACCCAAGCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-709s21c1
Sequence:CCGGGACAACTCACAGGTGATTAAGCTCGAGCTTAATCACCTGTGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.2-964s21c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027148
VALIDATED
EXOSC8 MISSION shRNA shRNA Plasmid DNA
exosome component 8
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000104065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-398s1c1
Sequence:CCGGCGCTGGAGTATTACAGGAGATCTCGAGATCTCCTGTAATACTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-964s1c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-537s1c1
Sequence:CCGGCACGGTCATTTGTGGCGTTAACTCGAGTTAACGCCACAAATGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-536s1c1
Sequence:CCGGCCACGGTCATTTGTGGCGTTACTCGAGTAACGCCACAAATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-820s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGTTACTCGAGTAACAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-765s21c1
Sequence:CCGGTAGACTACGATGGGAACATTTCTCGAGAAATGTTCCCATCGTAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.3-509s21c1
Sequence:CCGGACGGTCATTTGTGGCGTTAAACTCGAGTTTAACGCCACAAATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-864s21c1
Sequence:CCGGCTTTAGCCGAAGTCAATTTAACTCGAGTTAAATTGACTTCGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-892s21c1
Sequence:CCGGGCTTTAGCCGAAGTCAATTTACTCGAGTAAATTGACTTCGGCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-756s21c1
Sequence:CCGGCAAGCTTGCTTGGGTTCTATACTCGAGTATAGAACCCAAGCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-709s21c1
Sequence:CCGGGACAACTCACAGGTGATTAAGCTCGAGCTTAATCACCTGTGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.2-964s21c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027148
VALIDATED
EXOSC8 MISSION shRNA Lentiviral Transduction Particles
exosome component 8
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000104065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-398s1c1
Sequence:CCGGCGCTGGAGTATTACAGGAGATCTCGAGATCTCCTGTAATACTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-964s1c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-537s1c1
Sequence:CCGGCACGGTCATTTGTGGCGTTAACTCGAGTTAACGCCACAAATGACCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027148.2-536s1c1
Sequence:CCGGCCACGGTCATTTGTGGCGTTACTCGAGTAACGCCACAAATGACCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027148.2-820s1c1
Sequence:CCGGGCCTGCACATTTGCTTTGTTACTCGAGTAACAAAGCAAATGTGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-765s21c1
Sequence:CCGGTAGACTACGATGGGAACATTTCTCGAGAAATGTTCCCATCGTAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.3-509s21c1
Sequence:CCGGACGGTCATTTGTGGCGTTAAACTCGAGTTTAACGCCACAAATGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.3-864s21c1
Sequence:CCGGCTTTAGCCGAAGTCAATTTAACTCGAGTTAAATTGACTTCGGCTAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-892s21c1
Sequence:CCGGGCTTTAGCCGAAGTCAATTTACTCGAGTAAATTGACTTCGGCTAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-756s21c1
Sequence:CCGGCAAGCTTGCTTGGGTTCTATACTCGAGTATAGAACCCAAGCAAGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311338    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027148.2-709s21c1
Sequence:CCGGGACAACTCACAGGTGATTAAGCTCGAGCTTAATCACCTGTGAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027148.2-964s21c1
Sequence:CCGGGCTGTGTTTGATGACACTCTACTCGAGTAGAGTGTCATCAAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks