EMAIL THIS PAGE TO A FRIEND

EXOSC9

exosome component 9

58 Gene Product Result for
Synonyms: PM/Scl-75 PMSCL1 RRP45 Rrp45p p5 p6
UniProtKB ID: Q06265, Q12883, Q4W5P5, Q86Y41, Q86Y48
Gene ID:
Human(5393) Summary: This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(50911) exosome component 9
Rat(294975) exosome component 9
domestic guinea pig(100722848) exosome component 9
naked mole-rat(101718139) exosome component 9
sheep(101108309) exosome component 9
Zebrafish(450057) exosome component 9
chicken(619530) exosome component 9
cow(508005) exosome component 9
domestic cat(101088836) exosome component 9
dog(476093) exosome component 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005033 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005033 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005033 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019393 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019393 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019393 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001034194 Rosetta Predictions human pricing
NM_005033 Rosetta Predictions human pricing
NM_001025406 Rosetta Predictions rat pricing
NM_019393 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308139 predicted 877
2 SASI_Hs01_00065140 predicted 762
3 SASI_Hs01_00065141 predicted 565
4 SASI_Hs01_00065142 predicted 609
5 SASI_Hs01_00065143 predicted 955
6 SASI_Hs01_00065145 predicted 668
7 SASI_Hs01_00065146 predicted 562
8 SASI_Hs01_00065147 predicted 780
9 SASI_Hs01_00065148 predicted 794
10 SASI_Hs01_00065149 predicted 557
11 SASI_Hs01_00065144 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005033 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338819 predicted 873
2 SASI_Hs01_00148072 predicted 761
3 SASI_Hs01_00148073 predicted 564
4 SASI_Hs01_00148074 predicted 613
5 SASI_Hs01_00148075 predicted 955
6 SASI_Hs01_00148077 predicted 671
7 SASI_Hs01_00148078 predicted 556
8 SASI_Hs01_00148079 predicted 775
9 SASI_Hs01_00148080 predicted 793
10 SASI_Hs01_00148081 predicted 561
11 SASI_Hs01_00148076 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025406 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034068 predicted 710
2 SASI_Rn01_00034069 predicted 892
3 SASI_Rn01_00034070 predicted 431
4 SASI_Rn02_00203142 predicted 711
5 SASI_Rn01_00034071 predicted 370
6 SASI_Rn01_00034073 predicted 550
7 SASI_Rn01_00034074 predicted 348
8 SASI_Rn01_00034075 predicted 380
9 SASI_Rn01_00034076 predicted 249
10 SASI_Rn01_00034077 predicted 825
11 SASI_Rn01_00034072 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019393 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073066 predicted 198
2 SASI_Mm01_00073067 predicted 703
3 SASI_Mm01_00073068 predicted 1176
4 SASI_Mm01_00073069 predicted 408
5 SASI_Mm01_00073070 predicted 381
6 SASI_Mm01_00073071 predicted 759
7 SASI_Mm01_00073072 predicted 359
8 SASI_Mm01_00073073 predicted 749
9 SASI_Mm01_00073074 predicted 259
10 SASI_Mm01_00073075 predicted 759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005033
VALIDATED
EXOSC9 MISSION shRNA Bacterial Glycerol Stock
exosome component 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-768s21c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-505s21c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1267s21c1
Sequence:CCGGGCTCCCATAATACTCTCAGATCTCGAGATCTGAGAGTATTATGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1201s21c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-961s21c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1260s1c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-564s1c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005033.1-827s1c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1020s1c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005033
VALIDATED
EXOSC9 MISSION shRNA shRNA Plasmid DNA
exosome component 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-768s21c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-505s21c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1267s21c1
Sequence:CCGGGCTCCCATAATACTCTCAGATCTCGAGATCTGAGAGTATTATGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1201s21c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-961s21c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1260s1c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-564s1c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005033.1-827s1c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1020s1c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005033
VALIDATED
EXOSC9 MISSION shRNA Lentiviral Transduction Particles
exosome component 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-768s21c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-505s21c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1267s21c1
Sequence:CCGGGCTCCCATAATACTCTCAGATCTCGAGATCTGAGAGTATTATGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-1201s21c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005033.2-961s21c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1260s1c1
Sequence:CCGGGCTATCATTCTTGATGGTATACTCGAGTATACCATCAAGAATGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-564s1c1
Sequence:CCGGCGTGTAGACCTACATTTATTACTCGAGTAATAAATGTAGGTCTACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005033.1-827s1c1
Sequence:CCGGGCTGGTGATTGCCATGAACAACTCGAGTTGTTCATGGCAATCACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_005033.1-1020s1c1
Sequence:CCGGGCAGAGTCTATAGCAAATCAACTCGAGTTGATTTGCTATAGACTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019393
VALIDATED
EXOSC9 MISSION shRNA Bacterial Glycerol Stock
exosome component 9
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-473s21c1
Sequence:CCGGGATCCGTGTAGACCTACATTTCTCGAGAAATGTAGGTCTACACGGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-188s21c1
Sequence:CCGGGATCTCATTCGGAACGGATTACTCGAGTAATCCGTTCCGAATGAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-752s21c1
Sequence:CCGGCATGAATAAGCATCGAGAAATCTCGAGATTTCTCGATGCTTATTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-710s21c1
Sequence:CCGGTGAACGTGAAGAACGAGTAATCTCGAGATTACTCGTTCTTCACGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-155s21c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019393.1-1478s1c1
Sequence:CCGGCTGGGTATCTTACAAGCTGAACTCGAGTTCAGCTTGTAAGATACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-651s1c1
Sequence:CCGGGCCATTGAGCATCCACCATATCTCGAGATATGGTGGATGCTCAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019393.1-1231s1c1
Sequence:CCGGACTGGAGAAGTTTCTGATATTCTCGAGAATATCAGAAACTTCTCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-772s1c1
Sequence:CCGGGCCATGAATAAGCATCGAGAACTCGAGTTCTCGATGCTTATTCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019393.1-177s1c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019393
VALIDATED
EXOSC9 MISSION shRNA shRNA Plasmid DNA
exosome component 9
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-473s21c1
Sequence:CCGGGATCCGTGTAGACCTACATTTCTCGAGAAATGTAGGTCTACACGGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-188s21c1
Sequence:CCGGGATCTCATTCGGAACGGATTACTCGAGTAATCCGTTCCGAATGAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-752s21c1
Sequence:CCGGCATGAATAAGCATCGAGAAATCTCGAGATTTCTCGATGCTTATTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-710s21c1
Sequence:CCGGTGAACGTGAAGAACGAGTAATCTCGAGATTACTCGTTCTTCACGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-155s21c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019393.1-1478s1c1
Sequence:CCGGCTGGGTATCTTACAAGCTGAACTCGAGTTCAGCTTGTAAGATACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-651s1c1
Sequence:CCGGGCCATTGAGCATCCACCATATCTCGAGATATGGTGGATGCTCAATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019393.1-1231s1c1
Sequence:CCGGACTGGAGAAGTTTCTGATATTCTCGAGAATATCAGAAACTTCTCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-772s1c1
Sequence:CCGGGCCATGAATAAGCATCGAGAACTCGAGTTCTCGATGCTTATTCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000104027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019393.1-177s1c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019393
VALIDATED
EXOSC9 MISSION shRNA Lentiviral Transduction Particles
exosome component 9
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-473s21c1
Sequence:CCGGGATCCGTGTAGACCTACATTTCTCGAGAAATGTAGGTCTACACGGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-188s21c1
Sequence:CCGGGATCTCATTCGGAACGGATTACTCGAGTAATCCGTTCCGAATGAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313703    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-752s21c1
Sequence:CCGGCATGAATAAGCATCGAGAAATCTCGAGATTTCTCGATGCTTATTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019393.2-710s21c1
Sequence:CCGGTGAACGTGAAGAACGAGTAATCTCGAGATTACTCGTTCTTCACGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019393.2-155s21c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104025    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019393.1-1478s1c1
Sequence:CCGGCTGGGTATCTTACAAGCTGAACTCGAGTTCAGCTTGTAAGATACCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-651s1c1
Sequence:CCGGGCCATTGAGCATCCACCATATCTCGAGATATGGTGGATGCTCAATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019393.1-1231s1c1
Sequence:CCGGACTGGAGAAGTTTCTGATATTCTCGAGAATATCAGAAACTTCTCCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019393.1-772s1c1
Sequence:CCGGGCCATGAATAAGCATCGAGAACTCGAGTTCTCGATGCTTATTCATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000104027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019393.1-177s1c1
Sequence:CCGGCGGCAGACAGACCTATGATTACTCGAGTAATCATAGGTCTGTCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)