EMAIL THIS PAGE TO A FRIEND

EXPH5

exophilin 5

60 Gene Product Result for
Synonyms: SLAC2-B SLAC2B
UniProtKB ID: Q8NEV8, Q2KHM1, Q9Y4D6
Gene ID:
Mouse(320051) exophilin 5
Rat(315663) exophilin 5
chicken(101667510) exophilin 5
chicken(101748418) exophilin 5
dog(489418) exophilin 5
Horse(100061793) exophilin 5
cow(527048) exophilin 5
sheep(101106104) exophilin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015065 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015065 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015065 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_176846 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_176846 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_176846 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU091551 MISSION® esiRNA esiRNA human EXPH5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015065 Rosetta Predictions human pricing
XM_001072028 Rosetta Predictions rat pricing
XM_236272 Rosetta Predictions rat pricing
NM_176846 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038564 predicted 5685
2 SASI_Hs02_00346921 predicted 5185
3 SASI_Hs02_00346922 predicted 4604
4 SASI_Hs02_00346923 predicted 4678
5 SASI_Hs01_00038566 predicted 1213
6 SASI_Hs02_00346924 predicted 3843
7 SASI_Hs01_00038569 predicted 1853
8 SASI_Hs01_00038570 predicted 5488
9 SASI_Hs01_00038571 predicted 1866
10 SASI_Hs01_00038572 predicted 1402
11 SASI_Hs01_00038563 predicted 1666
12 SASI_Hs01_00038565 predicted 4432
13 SASI_Hs01_00038567 predicted 627
14 SASI_Hs01_00038568 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072028 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337464 predicted 1794
2 SASI_Rn02_00337465 predicted 4011
3 SASI_Rn02_00337466 predicted 5469
4 SASI_Rn02_00337467 predicted 241
5 SASI_Rn02_00337468 predicted 4663
6 SASI_Rn02_00337469 predicted 1490
7 SASI_Rn02_00337470 predicted 2902
8 SASI_Rn02_00337471 predicted 4129
9 SASI_Rn02_00337472 predicted 894
10 SASI_Rn02_00337473 predicted 3427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236272 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389934 predicted 1791
2 SASI_Rn02_00389935 predicted 4009
3 SASI_Rn02_00389936 predicted 235
4 SASI_Rn02_00389937 predicted 207
5 SASI_Rn02_00389938 predicted 1482
6 SASI_Rn02_00389939 predicted 2904
7 SASI_Rn02_00389940 predicted 895
8 SASI_Rn02_00389941 predicted 3427
9 SASI_Rn02_00389942 predicted 1211
10 SASI_Rn02_00389943 predicted 879
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176846 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00346752 predicted 979
2 SASI_Mm01_00200962 predicted 509
3 SASI_Mm01_00200963 predicted 2863
4 SASI_Mm01_00200964 predicted 4784
5 SASI_Mm01_00200965 predicted 5121
6 SASI_Mm01_00200966 predicted 5451
7 SASI_Mm01_00200968 predicted 5543
8 SASI_Mm02_00346753 predicted 1162
9 SASI_Mm01_00200969 predicted 1248
10 SASI_Mm02_00346754 predicted 2332
11 SASI_Mm01_00200960 predicted 2704
12 SASI_Mm01_00200961 predicted 1398
13 SASI_Mm01_00200967 predicted 746
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015065
VALIDATED
EXPH5 MISSION shRNA Bacterial Glycerol Stock
exophilin 5
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-2447s1c1
Sequence:CCGGCCGCACACAGATAAATCCAATCTCGAGATTGGATTTATCTGTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-4410s1c1
Sequence:CCGGCCCAAACTAGAAGAAGTTCTTCTCGAGAAGAACTTCTTCTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6232s1c1
Sequence:CCGGCCTGAATGCTAGAACAATGAACTCGAGTTCATTGTTCTAGCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-1542s1c1
Sequence:CCGGGCCAAGAGAAAGGACATTCTTCTCGAGAAGAATGTCCTTTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-3649s1c1
Sequence:CCGGCTTCCAAGAATACACTGAGAACTCGAGTTCTCAGTGTATTCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-4827s1c1
Sequence:CCGGCCAACTTGGATGACCTAGTAACTCGAGTTACTAGGTCATCCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-1447s1c1
Sequence:CCGGCTACCATCAAAGCAACACATTCTCGAGAATGTGTTGCTTTGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6435s1c1
Sequence:CCGGCTTATGAATTACCCAGCACAACTCGAGTTGTGCTGGGTAATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5960s1c1
Sequence:CCGGCCGCTTAATATCTATGAGGATCTCGAGATCCTCATAGATATTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5467s1c1
Sequence:CCGGCCTCTATCGTTCAAAGAGTTTCTCGAGAAACTCTTTGAACGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146398    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6332s1c1
Sequence:CCGGCCCTGATTCACTGTCTGATTTCTCGAGAAATCAGACAGTGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015065
VALIDATED
EXPH5 MISSION shRNA shRNA Plasmid DNA
exophilin 5
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-2447s1c1
Sequence:CCGGCCGCACACAGATAAATCCAATCTCGAGATTGGATTTATCTGTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-4410s1c1
Sequence:CCGGCCCAAACTAGAAGAAGTTCTTCTCGAGAAGAACTTCTTCTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6232s1c1
Sequence:CCGGCCTGAATGCTAGAACAATGAACTCGAGTTCATTGTTCTAGCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-1542s1c1
Sequence:CCGGGCCAAGAGAAAGGACATTCTTCTCGAGAAGAATGTCCTTTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-3649s1c1
Sequence:CCGGCTTCCAAGAATACACTGAGAACTCGAGTTCTCAGTGTATTCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-4827s1c1
Sequence:CCGGCCAACTTGGATGACCTAGTAACTCGAGTTACTAGGTCATCCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-1447s1c1
Sequence:CCGGCTACCATCAAAGCAACACATTCTCGAGAATGTGTTGCTTTGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6435s1c1
Sequence:CCGGCTTATGAATTACCCAGCACAACTCGAGTTGTGCTGGGTAATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5960s1c1
Sequence:CCGGCCGCTTAATATCTATGAGGATCTCGAGATCCTCATAGATATTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5467s1c1
Sequence:CCGGCCTCTATCGTTCAAAGAGTTTCTCGAGAAACTCTTTGAACGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146398    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6332s1c1
Sequence:CCGGCCCTGATTCACTGTCTGATTTCTCGAGAAATCAGACAGTGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015065
VALIDATED
EXPH5 MISSION shRNA Lentiviral Transduction Particles
exophilin 5
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-2447s1c1
Sequence:CCGGCCGCACACAGATAAATCCAATCTCGAGATTGGATTTATCTGTGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-4410s1c1
Sequence:CCGGCCCAAACTAGAAGAAGTTCTTCTCGAGAAGAACTTCTTCTAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6232s1c1
Sequence:CCGGCCTGAATGCTAGAACAATGAACTCGAGTTCATTGTTCTAGCATTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-1542s1c1
Sequence:CCGGGCCAAGAGAAAGGACATTCTTCTCGAGAAGAATGTCCTTTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150299    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-3649s1c1
Sequence:CCGGCTTCCAAGAATACACTGAGAACTCGAGTTCTCAGTGTATTCTTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149785    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-4827s1c1
Sequence:CCGGCCAACTTGGATGACCTAGTAACTCGAGTTACTAGGTCATCCAAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015065.1-1447s1c1
Sequence:CCGGCTACCATCAAAGCAACACATTCTCGAGAATGTGTTGCTTTGATGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146841    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6435s1c1
Sequence:CCGGCTTATGAATTACCCAGCACAACTCGAGTTGTGCTGGGTAATTCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5960s1c1
Sequence:CCGGCCGCTTAATATCTATGAGGATCTCGAGATCCTCATAGATATTAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146332    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015065.1-5467s1c1
Sequence:CCGGCCTCTATCGTTCAAAGAGTTTCTCGAGAAACTCTTTGAACGATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146398    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015065.1-6332s1c1
Sequence:CCGGCCCTGATTCACTGTCTGATTTCTCGAGAAATCAGACAGTGAATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176846
EXPH5 MISSION shRNA Bacterial Glycerol Stock
exophilin 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-762s1c1
Sequence:CCGGCGGATCAAGAACACAGTTCAACTCGAGTTGAACTGTGTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-5555s1c1
Sequence:CCGGGCTGGACTTCGTATAGCAATACTCGAGTATTGCTATACGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-3893s1c1
Sequence:CCGGCACTTCCTAATGCTTTAGAAACTCGAGTTTCTAAAGCATTAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-3770s21c1
Sequence:CCGGTTGAGGTGGTTTCAATCTATTCTCGAGAATAGATTGAAACCACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-2247s1c1
Sequence:CCGGCTCTAATGACTTACCTGATTTCTCGAGAAATCAGGTAAGTCATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-2554s21c1
Sequence:CCGGGAGAGTTCAAACACCATTAAACTCGAGTTTAATGGTGTTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1399s21c1
Sequence:CCGGTACCGTCAGAGTAACCCATTTCTCGAGAAATGGGTTACTCTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1873s21c1
Sequence:CCGGGTAGATGAGGACCCTTATTTGCTCGAGCAAATAAGGGTCCTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-4786s21c1
Sequence:CCGGAGATTGGCAGCCATATCTAAACTCGAGTTTAGATATGGCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176846
EXPH5 MISSION shRNA shRNA Plasmid DNA
exophilin 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-762s1c1
Sequence:CCGGCGGATCAAGAACACAGTTCAACTCGAGTTGAACTGTGTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-5555s1c1
Sequence:CCGGGCTGGACTTCGTATAGCAATACTCGAGTATTGCTATACGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-3893s1c1
Sequence:CCGGCACTTCCTAATGCTTTAGAAACTCGAGTTTCTAAAGCATTAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-3770s21c1
Sequence:CCGGTTGAGGTGGTTTCAATCTATTCTCGAGAATAGATTGAAACCACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-2247s1c1
Sequence:CCGGCTCTAATGACTTACCTGATTTCTCGAGAAATCAGGTAAGTCATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-2554s21c1
Sequence:CCGGGAGAGTTCAAACACCATTAAACTCGAGTTTAATGGTGTTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1399s21c1
Sequence:CCGGTACCGTCAGAGTAACCCATTTCTCGAGAAATGGGTTACTCTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1873s21c1
Sequence:CCGGGTAGATGAGGACCCTTATTTGCTCGAGCAAATAAGGGTCCTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-4786s21c1
Sequence:CCGGAGATTGGCAGCCATATCTAAACTCGAGTTTAGATATGGCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176846
EXPH5 MISSION shRNA Lentiviral Transduction Particles
exophilin 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193068    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-762s1c1
Sequence:CCGGCGGATCAAGAACACAGTTCAACTCGAGTTGAACTGTGTTCTTGATCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192706    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-5555s1c1
Sequence:CCGGGCTGGACTTCGTATAGCAATACTCGAGTATTGCTATACGAAGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-3893s1c1
Sequence:CCGGCACTTCCTAATGCTTTAGAAACTCGAGTTTCTAAAGCATTAGGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-3770s21c1
Sequence:CCGGTTGAGGTGGTTTCAATCTATTCTCGAGAATAGATTGAAACCACCTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215915    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_176846.2-2247s1c1
Sequence:CCGGCTCTAATGACTTACCTGATTTCTCGAGAAATCAGGTAAGTCATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246850    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-2554s21c1
Sequence:CCGGGAGAGTTCAAACACCATTAAACTCGAGTTTAATGGTGTTTGAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1399s21c1
Sequence:CCGGTACCGTCAGAGTAACCCATTTCTCGAGAAATGGGTTACTCTGACGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-1873s21c1
Sequence:CCGGGTAGATGAGGACCCTTATTTGCTCGAGCAAATAAGGGTCCTCATCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176846.2-4786s21c1
Sequence:CCGGAGATTGGCAGCCATATCTAAACTCGAGTTTAGATATGGCTGCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks