EMAIL THIS PAGE TO A FRIEND

EXT1

exostosin glycosyltransferase 1

88 Gene Product Result for
Synonyms: EXT LGCR LGS TRPS2 TTV
UniProtKB ID: Q16394, B2R7V2, Q9BVI9
Gene ID:
Human(2131) Summary: This gene encodes an endoplasmic reticulum-resident type II transmembrane glycosyltransferase involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type I form of multiple exostoses. [provided by RefSeq, Jul 2008]
Mouse(14042) exostoses (multiple) 1
Rat(299907) exostosin glycosyltransferase 1
chicken(420283) exostosin 1
cow(538602) exostosin 1
Horse(100056983) exostosin 1
dog(482024) exostosin 1
sheep(101114877) exostosin 1
domestic guinea pig(100716132) exostosin glycosyltransferase 1
naked mole-rat(101706257) exostosin glycosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000127 Rosetta Predictions human pricing
XM_001065900 Rosetta Predictions rat pricing
XM_216920 Rosetta Predictions rat pricing
NM_010162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245772 predicted 2065
2 SASI_Hs01_00245773 predicted 1711
3 SASI_Hs01_00245775 predicted 1724
4 SASI_Hs01_00245776 predicted 2171
5 SASI_Hs01_00245777 predicted 1726
6 SASI_Hs01_00245778 predicted 1742
7 SASI_Hs01_00245779 predicted 2712
8 SASI_Hs02_00301926 predicted 1120
9 SASI_Hs01_00245780 predicted 888
10 SASI_Hs01_00245781 predicted 2161
11 SASI_Hs01_00245774 predicted 1860
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065900 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00315660 predicted 1840
2 SASI_Rn02_00315661 predicted 1533
3 SASI_Rn02_00315662 predicted 1653
4 SASI_Rn02_00315663 predicted 1741
5 SASI_Rn02_00315664 predicted 1878
6 SASI_Rn02_00315665 predicted 1944
7 SASI_Rn02_00315666 predicted 2093
8 SASI_Rn02_00315667 predicted 1826
9 SASI_Rn02_00315668 predicted 1524
10 SASI_Rn02_00315669 predicted 1965
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376897 predicted 2059
2 SASI_Rn02_00376898 predicted 1754
3 SASI_Rn02_00376899 predicted 1877
4 SASI_Rn02_00376900 predicted 1957
5 SASI_Rn02_00376901 predicted 2096
6 SASI_Rn02_00376902 predicted 2162
7 SASI_Rn02_00376903 predicted 2315
8 SASI_Rn02_00376904 predicted 2045
9 SASI_Rn02_00376905 predicted 1746
10 SASI_Rn02_00376906 predicted 2190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185533 predicted 1773
2 SASI_Mm01_00185534 predicted 2208
3 SASI_Mm02_00317926 predicted 1963
4 SASI_Mm01_00185535 predicted 1987
5 SASI_Mm01_00185536 predicted 2223
6 SASI_Mm02_00317927 predicted 2198
7 SASI_Mm02_00317928 predicted 2132
8 SASI_Mm01_00185537 predicted 2069
9 SASI_Mm01_00185538 predicted 1765
10 SASI_Mm01_00185539 predicted 1324
11 SASI_Mm01_00185532 predicted 1864
12 SASI_Mm01_00185540 predicted 2362
13 SASI_Mm01_00185541 predicted 2421
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000127
VALIDATED
EXT1 MISSION shRNA Bacterial Glycerol Stock
exostosin glycosyltransferase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000350347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000127.2-3102s21c1
Sequence:CCGGAGCCAGATTGTGCCAACTATCCTCGAGGATAGTTGGCACAATCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-1725s21c1
Sequence:CCGGGAGTATGAGAAGTATGATTATCTCGAGATAATCATACTTCTCATACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2000s21c1
Sequence:CCGGATTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2723s21c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-965s21c1
Sequence:CCGGCTTCGTTCCTTGGGATCAATTCTCGAGAATTGATCCCAAGGAACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000127.1-3099s1c1
Sequence:CCGGAGAGCCAGATTGTGCCAACTACTCGAGTAGTTGGCACAATCTGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1979s1c1
Sequence:CCGGGCACTTAGACAGCAGACACAACTCGAGTTGTGTCTGCTGTCTAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-963s1c1
Sequence:CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1454s1c1
Sequence:CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1077s1c1
Sequence:CCGGCCTGCTTCGATTTCACCCTTTCTCGAGAAAGGGTGAAATCGAAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-884s1c1
Sequence:CCGGAAGAACACAGCGGTAGGAATCTCGAGATTCCTACCGCTGTGTTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-2722s1c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000127.x-3236s1c1
Sequence:CCGGCAAGACTAGGTTGGTACAGTTCTCGAGAACTGTACCAACCTAGTCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000127
VALIDATED
EXT1 MISSION shRNA shRNA Plasmid DNA
exostosin glycosyltransferase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000350347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000127.2-3102s21c1
Sequence:CCGGAGCCAGATTGTGCCAACTATCCTCGAGGATAGTTGGCACAATCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-1725s21c1
Sequence:CCGGGAGTATGAGAAGTATGATTATCTCGAGATAATCATACTTCTCATACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2000s21c1
Sequence:CCGGATTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2723s21c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-965s21c1
Sequence:CCGGCTTCGTTCCTTGGGATCAATTCTCGAGAATTGATCCCAAGGAACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000127.1-3099s1c1
Sequence:CCGGAGAGCCAGATTGTGCCAACTACTCGAGTAGTTGGCACAATCTGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1979s1c1
Sequence:CCGGGCACTTAGACAGCAGACACAACTCGAGTTGTGTCTGCTGTCTAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-963s1c1
Sequence:CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1454s1c1
Sequence:CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1077s1c1
Sequence:CCGGCCTGCTTCGATTTCACCCTTTCTCGAGAAAGGGTGAAATCGAAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-884s1c1
Sequence:CCGGAAGAACACAGCGGTAGGAATCTCGAGATTCCTACCGCTGTGTTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-2722s1c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000127.x-3236s1c1
Sequence:CCGGCAAGACTAGGTTGGTACAGTTCTCGAGAACTGTACCAACCTAGTCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000127
VALIDATED
EXT1 MISSION shRNA Lentiviral Transduction Particles
exostosin glycosyltransferase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000350347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000127.2-3102s21c1
Sequence:CCGGAGCCAGATTGTGCCAACTATCCTCGAGGATAGTTGGCACAATCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-1725s21c1
Sequence:CCGGGAGTATGAGAAGTATGATTATCTCGAGATAATCATACTTCTCATACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2000s21c1
Sequence:CCGGATTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-2723s21c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000127.2-965s21c1
Sequence:CCGGCTTCGTTCCTTGGGATCAATTCTCGAGAATTGATCCCAAGGAACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039993    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_000127.1-3099s1c1
Sequence:CCGGAGAGCCAGATTGTGCCAACTACTCGAGTAGTTGGCACAATCTGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1979s1c1
Sequence:CCGGGCACTTAGACAGCAGACACAACTCGAGTTGTGTCTGCTGTCTAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-963s1c1
Sequence:CCGGCCTTCGTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAACGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1454s1c1
Sequence:CCGGCCCAACTTTGATGTTTCTATTCTCGAGAATAGAAACATCAAAGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.1-1077s1c1
Sequence:CCGGCCTGCTTCGATTTCACCCTTTCTCGAGAAAGGGTGAAATCGAAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-884s1c1
Sequence:CCGGAAGAACACAGCGGTAGGAATCTCGAGATTCCTACCGCTGTGTTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_000127.x-2722s1c1
Sequence:CCGGCAATTGTGAGGACATTCTCATCTCGAGATGAGAATGTCCTCACAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018367    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000127.x-3236s1c1
Sequence:CCGGCAAGACTAGGTTGGTACAGTTCTCGAGAACTGTACCAACCTAGTCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010162
VALIDATED
EXT1 MISSION shRNA Bacterial Glycerol Stock
exostosin glycosyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2215s21c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2047s21c1
Sequence:CCGGGTTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2175s21c1
Sequence:CCGGTGTTCGTCCTACCGCAGTATTCTCGAGAATACTGCGGTAGGACGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-3154s21c1
Sequence:CCGGAGCCAGACTGTGCCAAGTATCCTCGAGGATACTTGGCACAGTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-1988s21c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1989s1c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2347s1c1
Sequence:CCGGCCAGAGAGGATTGTGGGATATCTCGAGATATCCCACAATCCTCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-785s1c1
Sequence:CCGGCCTTCTTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAAAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2127s1c1
Sequence:CCGGGCAGATCATAGTTCTGTGGAACTCGAGTTCCACAGAACTATGATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1762s1c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010162
VALIDATED
EXT1 MISSION shRNA shRNA Plasmid DNA
exostosin glycosyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2215s21c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2047s21c1
Sequence:CCGGGTTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2175s21c1
Sequence:CCGGTGTTCGTCCTACCGCAGTATTCTCGAGAATACTGCGGTAGGACGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-3154s21c1
Sequence:CCGGAGCCAGACTGTGCCAAGTATCCTCGAGGATACTTGGCACAGTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-1988s21c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1989s1c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2347s1c1
Sequence:CCGGCCAGAGAGGATTGTGGGATATCTCGAGATATCCCACAATCCTCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-785s1c1
Sequence:CCGGCCTTCTTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAAAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2127s1c1
Sequence:CCGGGCAGATCATAGTTCTGTGGAACTCGAGTTCCACAGAACTATGATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000093790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1762s1c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010162
VALIDATED
EXT1 MISSION shRNA Lentiviral Transduction Particles
exostosin glycosyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2215s21c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2047s21c1
Sequence:CCGGGTTCTTGTGGGAGGCTTATTTCTCGAGAAATAAGCCTCCCACAAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313799    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-2175s21c1
Sequence:CCGGTGTTCGTCCTACCGCAGTATTCTCGAGAATACTGCGGTAGGACGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-3154s21c1
Sequence:CCGGAGCCAGACTGTGCCAAGTATCCTCGAGGATACTTGGCACAGTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010162.2-1988s21c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1989s1c1
Sequence:CCGGCCCTTACTACTATGCTAATTTCTCGAGAAATTAGCATAGTAGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2347s1c1
Sequence:CCGGCCAGAGAGGATTGTGGGATATCTCGAGATATCCCACAATCCTCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-785s1c1
Sequence:CCGGCCTTCTTTCCTTGGGATCAATCTCGAGATTGATCCCAAGGAAAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010162.1-2127s1c1
Sequence:CCGGGCAGATCATAGTTCTGTGGAACTCGAGTTCCACAGAACTATGATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000093790    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010162.1-1762s1c1
Sequence:CCGGCCTTCTACAATCAGGTCTATTCTCGAGAATAGACCTGATTGTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)