EMAIL THIS PAGE TO A FRIEND

EXT2

exostosin glycosyltransferase 2

67 Gene Product Result for
Synonyms: SOTV
UniProtKB ID: Q93063, B2R5Z6, C9JU51, J3KPT2, O15288
Gene ID:
Human(2132) Summary: This gene encodes one of two glycosyltransferases involved in the chain elongation step of heparan sulfate biosynthesis. Mutations in this gene cause the type II form of multiple exostoses. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jul 2008]
Mouse(14043) exostoses (multiple) 2
Rat(311215) exostosin glycosyltransferase 2
Zebrafish(493780) exostoses (multiple) 2
cow(281151) exostosin 2
Horse(100055879) exostosin 2
dog(475989) exostosin 2
fruit fly(3772101) CG8433 gene product from transcript CG8433-RA
chicken(425859) exostosin 2
naked mole-rat(101715817) exostosin glycosyltransferase 2
domestic guinea pig(100712625) exostosin glycosyltransferase 2
sheep(101110867) exostosin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000401 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000401 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000401 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000401 Rosetta Predictions human pricing
NM_207122 Rosetta Predictions human pricing
NM_001107751 Rosetta Predictions rat pricing
NM_010163 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090756 predicted 1673
2 SASI_Hs01_00090757 predicted 1738
3 SASI_Hs01_00090759 predicted 2140
4 SASI_Hs01_00090760 predicted 905
5 SASI_Hs01_00090761 predicted 1025
6 SASI_Hs02_00302477 predicted 1163
7 SASI_Hs02_00302478 predicted 1072
8 SASI_Hs02_00302479 predicted 826
9 SASI_Hs01_00090762 predicted 1422
10 SASI_Hs01_00090764 predicted 1594
11 SASI_Hs01_00090758 predicted 2098
12 SASI_Hs01_00090763 predicted 983
13 SASI_Hs01_00090765 predicted 1149
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066227 predicted 1526
2 SASI_Hs01_00066228 predicted 1588
3 SASI_Hs01_00066230 predicted 1979
4 SASI_Hs01_00066231 predicted 751
5 SASI_Hs01_00066232 predicted 879
6 SASI_Hs02_00373775 predicted 1005
7 SASI_Hs02_00373776 predicted 917
8 SASI_Hs02_00373777 predicted 676
9 SASI_Hs01_00066233 predicted 1274
10 SASI_Hs01_00066235 predicted 1434
11 SASI_Hs01_00066229 predicted 1945
12 SASI_Hs01_00066234 predicted 836
13 SASI_Hs01_00066236 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231905 predicted 1831
2 SASI_Rn02_00231906 predicted 1034
3 SASI_Rn02_00231907 predicted 1220
4 SASI_Rn02_00231908 predicted 1920
5 SASI_Rn02_00231909 predicted 1931
6 SASI_Rn02_00231910 predicted 1122
7 SASI_Rn02_00231911 predicted 2146
8 SASI_Rn02_00231912 predicted 1460
9 SASI_Rn02_00231913 predicted 2313
10 SASI_Rn02_00231914 predicted 1236
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046637 predicted 1212
2 SASI_Mm01_00046638 predicted 654
3 SASI_Mm01_00046639 predicted 437
4 SASI_Mm01_00046640 predicted 2052
5 SASI_Mm01_00046641 predicted 1374
6 SASI_Mm01_00046642 predicted 1842
7 SASI_Mm01_00046643 predicted 1374
8 SASI_Mm01_00046644 predicted 1678
9 SASI_Mm01_00046645 predicted 1443
10 SASI_Mm01_00046646 predicted 1270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000401
VALIDATED
EXT2 MISSION shRNA Bacterial Glycerol Stock
exostosin glycosyltransferase 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000401.x-2366s1c1
Sequence:CCGGAAGATATTGCCATGAACTTCCTCGAGGAAGTTCATGGCAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000401.x-3308s1c1
Sequence:CCGGCAATTCCTGATAGTCCAAGGACTCGAGTCCTTGGACTATCAGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGTATTTCTTACTCGAGTAAGAAATACAAGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-627s1c1
Sequence:CCGGCCCATTCTATCGAGTCCTCAACTCGAGTTGAGGACTCGATAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000401.1-1720s1c1
Sequence:CCGGGCAGATTATCAATGACCGGATCTCGAGATCCGGTCATTGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2209s1c1
Sequence:CCGGCCATGAGATGAATAAGTGGAACTCGAGTTCCACTTATTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-3331s21c1
Sequence:GTACCGGCACCTTTCTCCCTTGATATATCTCGAGATATATCAAGGGAGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2094s21c1
Sequence:CCGGCCATTGATGATGATATCATTACTCGAGTAATGATATCATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1678s21c1
Sequence:CCGGAGCGTACTTCCAGTCAATTAACTCGAGTTAATTGACTGGAAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1514s21c1
Sequence:CCGGGTCATTGCAGACTCCTATATTCTCGAGAATATAGGAGTCTGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2144s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000401
VALIDATED
EXT2 MISSION shRNA shRNA Plasmid DNA
exostosin glycosyltransferase 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000401.x-2366s1c1
Sequence:CCGGAAGATATTGCCATGAACTTCCTCGAGGAAGTTCATGGCAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000401.x-3308s1c1
Sequence:CCGGCAATTCCTGATAGTCCAAGGACTCGAGTCCTTGGACTATCAGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGTATTTCTTACTCGAGTAAGAAATACAAGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-627s1c1
Sequence:CCGGCCCATTCTATCGAGTCCTCAACTCGAGTTGAGGACTCGATAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000401.1-1720s1c1
Sequence:CCGGGCAGATTATCAATGACCGGATCTCGAGATCCGGTCATTGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2209s1c1
Sequence:CCGGCCATGAGATGAATAAGTGGAACTCGAGTTCCACTTATTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-3331s21c1
Sequence:GTACCGGCACCTTTCTCCCTTGATATATCTCGAGATATATCAAGGGAGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2094s21c1
Sequence:CCGGCCATTGATGATGATATCATTACTCGAGTAATGATATCATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1678s21c1
Sequence:CCGGAGCGTACTTCCAGTCAATTAACTCGAGTTAATTGACTGGAAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1514s21c1
Sequence:CCGGGTCATTGCAGACTCCTATATTCTCGAGAATATAGGAGTCTGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2144s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000401
VALIDATED
EXT2 MISSION shRNA Lentiviral Transduction Particles
exostosin glycosyltransferase 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_000401.x-2366s1c1
Sequence:CCGGAAGATATTGCCATGAACTTCCTCGAGGAAGTTCATGGCAATATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010493    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000401.x-3308s1c1
Sequence:CCGGCAATTCCTGATAGTCCAAGGACTCGAGTCCTTGGACTATCAGGAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2839s1c1
Sequence:CCGGCCTCTGTTCTTGTATTTCTTACTCGAGTAAGAAATACAAGAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039850    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-627s1c1
Sequence:CCGGCCCATTCTATCGAGTCCTCAACTCGAGTTGAGGACTCGATAGAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000401.1-1720s1c1
Sequence:CCGGGCAGATTATCAATGACCGGATCTCGAGATCCGGTCATTGATAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039852    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000401.1-2209s1c1
Sequence:CCGGCCATGAGATGAATAAGTGGAACTCGAGTTCCACTTATTCATCTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218705    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-3331s21c1
Sequence:GTACCGGCACCTTTCTCCCTTGATATATCTCGAGATATATCAAGGGAGAAAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2094s21c1
Sequence:CCGGCCATTGATGATGATATCATTACTCGAGTAATGATATCATCATCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1678s21c1
Sequence:CCGGAGCGTACTTCCAGTCAATTAACTCGAGTTAATTGACTGGAAGTACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-1514s21c1
Sequence:CCGGGTCATTGCAGACTCCTATATTCTCGAGAATATAGGAGTCTGCAATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_000401.2-2144s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010163
VALIDATED
EXT2 MISSION shRNA Bacterial Glycerol Stock
exostosin glycosyltransferase 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2683s1c1
Sequence:CCGGCATGGGCTACAGATCCCAATACTCGAGTATTGGGATCTGTAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2055s1c1
Sequence:CCGGGCTCACATGAACTGTGAAGATCTCGAGATCTTCACAGTTCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-1383s1c1
Sequence:CCGGGCATACTTCCAGTCCATTAAACTCGAGTTTAATGGACTGGAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-611s1c1
Sequence:CCGGCGACTACTACACAGACGACATCTCGAGATGTCGTCTGTGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2211s1c1
Sequence:CCGGTCTGAGTGCATCAACAAGTTTCTCGAGAAACTTGTTGATGCACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1869s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-465s21c1
Sequence:CCGGTGTAGAATGCATACGTGTTTCCTCGAGGAAACACGTATGCATTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-763s21c1
Sequence:CCGGCAAATCACCTGCTGTTCAATACTCGAGTATTGAACAGCAGGTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1239s21c1
Sequence:CCGGGTCATTGCAGACTCTTATATTCTCGAGAATATAAGAGTCTGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010163.3-2586s21c1
Sequence:CCGGATCTCACTGGCCCTACAACTGCTCGAGCAGTTGTAGGGCCAGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-322s21c1
Sequence:CCGGTCATAGCCACGGGCATGTTTCCTCGAGGAAACATGCCCGTGGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010163
VALIDATED
EXT2 MISSION shRNA shRNA Plasmid DNA
exostosin glycosyltransferase 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2683s1c1
Sequence:CCGGCATGGGCTACAGATCCCAATACTCGAGTATTGGGATCTGTAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2055s1c1
Sequence:CCGGGCTCACATGAACTGTGAAGATCTCGAGATCTTCACAGTTCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-1383s1c1
Sequence:CCGGGCATACTTCCAGTCCATTAAACTCGAGTTTAATGGACTGGAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-611s1c1
Sequence:CCGGCGACTACTACACAGACGACATCTCGAGATGTCGTCTGTGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2211s1c1
Sequence:CCGGTCTGAGTGCATCAACAAGTTTCTCGAGAAACTTGTTGATGCACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1869s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-465s21c1
Sequence:CCGGTGTAGAATGCATACGTGTTTCCTCGAGGAAACACGTATGCATTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-763s21c1
Sequence:CCGGCAAATCACCTGCTGTTCAATACTCGAGTATTGAACAGCAGGTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1239s21c1
Sequence:CCGGGTCATTGCAGACTCTTATATTCTCGAGAATATAAGAGTCTGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010163.3-2586s21c1
Sequence:CCGGATCTCACTGGCCCTACAACTGCTCGAGCAGTTGTAGGGCCAGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-322s21c1
Sequence:CCGGTCATAGCCACGGGCATGTTTCCTCGAGGAAACATGCCCGTGGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010163
VALIDATED
EXT2 MISSION shRNA Lentiviral Transduction Particles
exostosin glycosyltransferase 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2683s1c1
Sequence:CCGGCATGGGCTACAGATCCCAATACTCGAGTATTGGGATCTGTAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2055s1c1
Sequence:CCGGGCTCACATGAACTGTGAAGATCTCGAGATCTTCACAGTTCATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-1383s1c1
Sequence:CCGGGCATACTTCCAGTCCATTAAACTCGAGTTTAATGGACTGGAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-611s1c1
Sequence:CCGGCGACTACTACACAGACGACATCTCGAGATGTCGTCTGTGTAGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010163.1-2211s1c1
Sequence:CCGGTCTGAGTGCATCAACAAGTTTCTCGAGAAACTTGTTGATGCACTCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1869s21c1
Sequence:CCGGTATGAGGTCTGGCGGGAATTTCTCGAGAAATTCCCGCCAGACCTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-465s21c1
Sequence:CCGGTGTAGAATGCATACGTGTTTCCTCGAGGAAACACGTATGCATTCTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-763s21c1
Sequence:CCGGCAAATCACCTGCTGTTCAATACTCGAGTATTGAACAGCAGGTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421168    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-1239s21c1
Sequence:CCGGGTCATTGCAGACTCTTATATTCTCGAGAATATAAGAGTCTGCAATGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010163.3-2586s21c1
Sequence:CCGGATCTCACTGGCCCTACAACTGCTCGAGCAGTTGTAGGGCCAGTGAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010163.3-322s21c1
Sequence:CCGGTCATAGCCACGGGCATGTTTCCTCGAGGAAACATGCCCGTGGCTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks