EMAIL THIS PAGE TO A FRIEND

EXTL1

exostosin-like glycosyltransferase 1

53 Gene Product Result for
Synonyms: EXTL
UniProtKB ID: Q92935, Q6GSC1
Gene ID:
Human(2134) Summary: This gene is a member of the multiple exostoses (EXT) family of glycosyltransferases, which function in the chain polymerization of heparan sulfate and heparin. The encoded protein harbors alpha 1,4- N-acetylglucosaminyltransferase activity, and is involved in chain elongation of heparan sulfate and possibly heparin. [provided by RefSeq, Jul 2008]
Mouse(56219) exostoses (multiple)-like 1
Rat(313610) exostosin-like glycosyltransferase 1
dog(487363) exostoses (multiple)-like 1
domestic cat(101083693) exostoses (multiple)-like 1
cow(511060) exostoses (multiple)-like 1
Horse(100071242) exostoses (multiple)-like 1
sheep(101113394) exostoses (multiple)-like 1
Domestic Rabbit(100347418) exostoses (multiple)-like 1
domestic guinea pig(100732210) exostosin-like glycosyltransferase 1
naked mole-rat(101705292) exostosin-like glycosyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019578 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019578 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019578 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004455 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004455 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004455 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU046341 MISSION® esiRNA esiRNA targeting mouse Extl1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004455 Rosetta Predictions human pricing
NM_001107985 Rosetta Predictions rat pricing
NM_019578 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004455 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337637 predicted 2301
2 SASI_Hs01_00159145 predicted 1142
3 SASI_Hs01_00159147 predicted 2527
4 SASI_Hs02_00337638 predicted 2484
5 SASI_Hs01_00159148 predicted 2492
6 SASI_Hs02_00337639 predicted 1296
7 SASI_Hs02_00337640 predicted 1292
8 SASI_Hs02_00337641 predicted 2305
9 SASI_Hs02_00337642 predicted 1051
10 SASI_Hs02_00337643 predicted 2291
11 SASI_Hs01_00159143 predicted 1948
12 SASI_Hs01_00159144 predicted 1970
13 SASI_Hs01_00159146 predicted 3155
14 SASI_Hs01_00159149 predicted 2550
15 SASI_Hs01_00159150 predicted 3361
16 SASI_Hs01_00159151 predicted 2319
17 SASI_Hs01_00159152 predicted 1964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234225 predicted 1796
2 SASI_Rn02_00234226 predicted 1479
3 SASI_Rn02_00234227 predicted 894
4 SASI_Rn02_00234228 predicted 865
5 SASI_Rn02_00234229 predicted 2009
6 SASI_Rn02_00234230 predicted 1126
7 SASI_Rn02_00234231 predicted 200
8 SASI_Rn02_00234232 predicted 1703
9 SASI_Rn02_00234233 predicted 714
10 SASI_Rn02_00234234 predicted 2027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019578 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022406 predicted 2556
2 SASI_Mm02_00324642 predicted 2246
3 SASI_Mm01_00022408 predicted 2808
4 SASI_Mm01_00022409 predicted 2276
5 SASI_Mm01_00022410 predicted 2524
6 SASI_Mm01_00022411 predicted 2272
7 SASI_Mm02_00324643 predicted 1384
8 SASI_Mm01_00022412 predicted 1096
9 SASI_Mm01_00022413 predicted 2747
10 SASI_Mm01_00022414 predicted 2303
11 SASI_Mm01_00022407 predicted 1128
12 SASI_Mm01_00022415 predicted 741
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019578
EXTL1 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2779s21c1
Sequence:CCGGGTTGTTCAAGGACCCGGTATCCTCGAGGATACCGGGTCCTTGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1379s21c1
Sequence:CCGGTTCCGACCGGGCTTCGATTTACTCGAGTAAATCGAAGCCCGGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2139s21c1
Sequence:CCGGACTGTGCCCAGATCCTGATTCCTCGAGGAATCAGGATCTGGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-2875s21c1
Sequence:CCGGACCAACAGAGATGGATCAAAGCTCGAGCTTTGATCCATCTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2316s21c1
Sequence:CCGGCTACCAGTGAGGTGGACTTTGCTCGAGCAAAGTCCACCTCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-3221s21c1
Sequence:CCGGCAATAGCTGCAAGAGTATTAACTCGAGTTAATACTCTTGCAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2703s21c1
Sequence:CCGGAGGACTGCATCAACCGTTTAGCTCGAGCTAAACGGTTGATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1893s21c1
Sequence:CCGGTCCATACCACCCTAGAGATTACTCGAGTAATCTCTAGGGTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-2039s1c1
Sequence:CCGGCGCAAGAAGTATCGCAGTCTACTCGAGTAGACTGCGATACTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1934s1c1
Sequence:CCGGCAGGACTGCATCAACCGTTTACTCGAGTAAACGGTTGATGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1032s1c1
Sequence:CCGGCCCTCCGTGAAATGCTCCCTTCTCGAGAAGGGAGCATTTCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019578
EXTL1 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2779s21c1
Sequence:CCGGGTTGTTCAAGGACCCGGTATCCTCGAGGATACCGGGTCCTTGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1379s21c1
Sequence:CCGGTTCCGACCGGGCTTCGATTTACTCGAGTAAATCGAAGCCCGGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2139s21c1
Sequence:CCGGACTGTGCCCAGATCCTGATTCCTCGAGGAATCAGGATCTGGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-2875s21c1
Sequence:CCGGACCAACAGAGATGGATCAAAGCTCGAGCTTTGATCCATCTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2316s21c1
Sequence:CCGGCTACCAGTGAGGTGGACTTTGCTCGAGCAAAGTCCACCTCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-3221s21c1
Sequence:CCGGCAATAGCTGCAAGAGTATTAACTCGAGTTAATACTCTTGCAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2703s21c1
Sequence:CCGGAGGACTGCATCAACCGTTTAGCTCGAGCTAAACGGTTGATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1893s21c1
Sequence:CCGGTCCATACCACCCTAGAGATTACTCGAGTAATCTCTAGGGTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-2039s1c1
Sequence:CCGGCGCAAGAAGTATCGCAGTCTACTCGAGTAGACTGCGATACTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1934s1c1
Sequence:CCGGCAGGACTGCATCAACCGTTTACTCGAGTAAACGGTTGATGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1032s1c1
Sequence:CCGGCCCTCCGTGAAATGCTCCCTTCTCGAGAAGGGAGCATTTCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019578
EXTL1 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2779s21c1
Sequence:CCGGGTTGTTCAAGGACCCGGTATCCTCGAGGATACCGGGTCCTTGAACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376707    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1379s21c1
Sequence:CCGGTTCCGACCGGGCTTCGATTTACTCGAGTAAATCGAAGCCCGGTCGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375099    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2139s21c1
Sequence:CCGGACTGTGCCCAGATCCTGATTCCTCGAGGAATCAGGATCTGGGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375098    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-2875s21c1
Sequence:CCGGACCAACAGAGATGGATCAAAGCTCGAGCTTTGATCCATCTCTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376775    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2316s21c1
Sequence:CCGGCTACCAGTGAGGTGGACTTTGCTCGAGCAAAGTCCACCTCACTGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019578.2-3221s21c1
Sequence:CCGGCAATAGCTGCAAGAGTATTAACTCGAGTTAATACTCTTGCAGCTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366310    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-2703s21c1
Sequence:CCGGAGGACTGCATCAACCGTTTAGCTCGAGCTAAACGGTTGATGCAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019578.2-1893s21c1
Sequence:CCGGTCCATACCACCCTAGAGATTACTCGAGTAATCTCTAGGGTGGTATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-2039s1c1
Sequence:CCGGCGCAAGAAGTATCGCAGTCTACTCGAGTAGACTGCGATACTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110298    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1934s1c1
Sequence:CCGGCAGGACTGCATCAACCGTTTACTCGAGTAAACGGTTGATGCAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019578.1-1032s1c1
Sequence:CCGGCCCTCCGTGAAATGCTCCCTTCTCGAGAAGGGAGCATTTCACGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004455
EXTL1 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1143s21c1
Sequence:CCGGGGGCGATGGCCTTAAGGTATTCTCGAGAATACCTTAAGGCCATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1955s21c1
Sequence:CCGGATACCACTCTGGAGGTTATTCCTCGAGGAATAACCTCCAGAGTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004455.2-3358s21c1
Sequence:CCGGGCCGCAAATATTTGACGAATACTCGAGTATTCGTCAAATATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2304s21c1
Sequence:CCGGTGATCGCTTCTACCCATATAGCTCGAGCTATATGGGTAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2531s21c1
Sequence:CCGGCCGCCTTCTACCATAGGTATTCTCGAGAATACCTATGGTAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004455.1-1225s1c1
Sequence:CCGGGCTCTCGCTTCTACACATTCACTCGAGTGAATGTGTAGAAGCGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004455
EXTL1 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1143s21c1
Sequence:CCGGGGGCGATGGCCTTAAGGTATTCTCGAGAATACCTTAAGGCCATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1955s21c1
Sequence:CCGGATACCACTCTGGAGGTTATTCCTCGAGGAATAACCTCCAGAGTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004455.2-3358s21c1
Sequence:CCGGGCCGCAAATATTTGACGAATACTCGAGTATTCGTCAAATATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2304s21c1
Sequence:CCGGTGATCGCTTCTACCCATATAGCTCGAGCTATATGGGTAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2531s21c1
Sequence:CCGGCCGCCTTCTACCATAGGTATTCTCGAGAATACCTATGGTAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004455.1-1225s1c1
Sequence:CCGGGCTCTCGCTTCTACACATTCACTCGAGTGAATGTGTAGAAGCGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004455
EXTL1 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1143s21c1
Sequence:CCGGGGGCGATGGCCTTAAGGTATTCTCGAGAATACCTTAAGGCCATCGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-1955s21c1
Sequence:CCGGATACCACTCTGGAGGTTATTCCTCGAGGAATAACCTCCAGAGTGGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244182    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004455.2-3358s21c1
Sequence:CCGGGCCGCAAATATTTGACGAATACTCGAGTATTCGTCAAATATTTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2304s21c1
Sequence:CCGGTGATCGCTTCTACCCATATAGCTCGAGCTATATGGGTAGAAGCGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004455.2-2531s21c1
Sequence:CCGGCCGCCTTCTACCATAGGTATTCTCGAGAATACCTATGGTAGAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004455.1-1225s1c1
Sequence:CCGGGCTCTCGCTTCTACACATTCACTCGAGTGAATGTGTAGAAGCGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks