EMAIL THIS PAGE TO A FRIEND

EXTL2

exostosin-like glycosyltransferase 2

125 Gene Product Result for
Synonyms: EXTR2
UniProtKB ID: Q9UBQ6, B2R795, D3DT60
Gene ID:
Mouse(58193) exostoses (multiple)-like 2
Rat(310803) exostosin-like glycosyltransferase 2
naked mole-rat(101726394) exostosin-like glycosyltransferase 2
domestic guinea pig(100732343) exostosin-like glycosyltransferase 2
sheep(101115079) exostoses (multiple)-like 2
Zebrafish(558373) exotoses (multiple)-like 2
chicken(424465) exostoses (multiple)-like 2
dog(479925) exostoses (multiple)-like 2
cow(540527) exostoses (multiple)-like 2
domestic cat(101089128) exostoses (multiple)-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001439 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001439 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001439 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021388 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021388 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021388 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033025 Rosetta Predictions human pricing
NM_001439 Rosetta Predictions human pricing
NM_001100704 Rosetta Predictions rat pricing
NM_021388 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033025 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019812 predicted 940
2 SASI_Hs01_00019813 predicted 494
3 SASI_Hs01_00019814 predicted 853
4 SASI_Hs01_00019815 predicted 800
5 SASI_Hs01_00019816 predicted 844
6 SASI_Hs01_00019817 predicted 809
7 SASI_Hs02_00307969 predicted 904
8 SASI_Hs01_00019819 predicted 559
9 SASI_Hs01_00019820 predicted 488
10 SASI_Hs02_00307970 predicted 997
11 SASI_Hs01_00019818 predicted 1026
12 SASI_Hs01_00019821 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218681 predicted 976
2 SASI_Hs01_00218682 predicted 536
3 SASI_Hs01_00218683 predicted 893
4 SASI_Hs01_00218684 predicted 832
5 SASI_Hs01_00218685 predicted 876
6 SASI_Hs01_00218686 predicted 848
7 SASI_Hs02_00331845 predicted 939
8 SASI_Hs01_00218688 predicted 597
9 SASI_Hs01_00218689 predicted 528
10 SASI_Hs02_00331846 predicted 1034
11 SASI_Hs01_00218687 predicted 1066
12 SASI_Hs01_00218690 predicted 623
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210338 predicted 402
2 SASI_Rn02_00210339 predicted 967
3 SASI_Rn02_00210340 predicted 335
4 SASI_Rn02_00210341 predicted 354
5 SASI_Rn02_00210342 predicted 547
6 SASI_Rn02_00210343 predicted 994
7 SASI_Rn02_00210344 predicted 602
8 SASI_Rn02_00210345 predicted 833
9 SASI_Rn02_00210346 predicted 951
10 SASI_Rn02_00210347 predicted 695
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021388 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00059020 predicted 703
2 SASI_Mm01_00059024 predicted 1209
3 SASI_Mm01_00059025 predicted 984
4 SASI_Mm01_00059026 predicted 1125
5 SASI_Mm02_00325981 predicted 704
6 SASI_Mm01_00059027 predicted 662
7 SASI_Mm01_00059028 predicted 666
8 SASI_Mm01_00059029 predicted 1020
9 SASI_Mm02_00325982 predicted 686
10 SASI_Mm02_00325983 predicted 803
11 SASI_Mm01_00059021 predicted 998
12 SASI_Mm01_00059022 predicted 1261
13 SASI_Mm01_00059023 predicted 777
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001439
VALIDATED
EXTL2 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1409s1c1
Sequence:CCGGGCAGTGCTTCTAGGATATAAACTCGAGTTTATATCCTAGAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001439.1-984s1c1
Sequence:CCGGGTCCATGCTTTGATAGATGATCTCGAGATCATCTATCAAAGCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1910s1c1
Sequence:CCGGCGTCTAGTTGTTTGCTTGATACTCGAGTATCAAGCAAACAACTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-836s1c1
Sequence:CCGGCTCTACTTCATCAGGTATCTACTCGAGTAGATACCTGATGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-1203s21c1
Sequence:CCGGACGCTCTGCAGAGGTCTTATTCTCGAGAATAAGACCTCTGCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-382s21c1
Sequence:CCGGGATTCGAGTGCTTCGATTATCCTCGAGGATAATCGAAGCACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-404s21c1
Sequence:CCGGTTGGTGGTCATCCTCGTATTACTCGAGTAATACGAGGATGACCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001439
VALIDATED
EXTL2 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1409s1c1
Sequence:CCGGGCAGTGCTTCTAGGATATAAACTCGAGTTTATATCCTAGAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001439.1-984s1c1
Sequence:CCGGGTCCATGCTTTGATAGATGATCTCGAGATCATCTATCAAAGCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1910s1c1
Sequence:CCGGCGTCTAGTTGTTTGCTTGATACTCGAGTATCAAGCAAACAACTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-836s1c1
Sequence:CCGGCTCTACTTCATCAGGTATCTACTCGAGTAGATACCTGATGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-1203s21c1
Sequence:CCGGACGCTCTGCAGAGGTCTTATTCTCGAGAATAAGACCTCTGCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-382s21c1
Sequence:CCGGGATTCGAGTGCTTCGATTATCCTCGAGGATAATCGAAGCACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-404s21c1
Sequence:CCGGTTGGTGGTCATCCTCGTATTACTCGAGTAATACGAGGATGACCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001439
VALIDATED
EXTL2 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1409s1c1
Sequence:CCGGGCAGTGCTTCTAGGATATAAACTCGAGTTTATATCCTAGAAGCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001439.1-984s1c1
Sequence:CCGGGTCCATGCTTTGATAGATGATCTCGAGATCATCTATCAAAGCATGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-1910s1c1
Sequence:CCGGCGTCTAGTTGTTTGCTTGATACTCGAGTATCAAGCAAACAACTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001439.1-836s1c1
Sequence:CCGGCTCTACTTCATCAGGTATCTACTCGAGTAGATACCTGATGAAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-1203s21c1
Sequence:CCGGACGCTCTGCAGAGGTCTTATTCTCGAGAATAAGACCTCTGCAGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-382s21c1
Sequence:CCGGGATTCGAGTGCTTCGATTATCCTCGAGGATAATCGAAGCACTCGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_001439.2-404s21c1
Sequence:CCGGTTGGTGGTCATCCTCGTATTACTCGAGTAATACGAGGATGACCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021388
VALIDATED
EXTL2 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1683s1c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-708s1c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1251s1c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-964s1c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1347s1c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021388.3-1682s21c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-707s21c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-963s21c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1250s21c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1346s21c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021388
VALIDATED
EXTL2 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1683s1c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-708s1c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1251s1c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-964s1c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1347s1c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021388.3-1682s21c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-707s21c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-963s21c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1250s21c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1346s21c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021388
VALIDATED
EXTL2 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093649    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1683s1c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-708s1c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1251s1c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-964s1c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021388.2-1347s1c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326015    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021388.3-1682s21c1
Sequence:CCGGCGGGATAGGATTTCCTGTGAACTCGAGTTCACAGGAAATCCTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-707s21c1
Sequence:CCGGCCTCTTACTAAGACTCTTAAACTCGAGTTTAAGAGTCTTAGTAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-963s21c1
Sequence:CCGGGCTTTCTCAATTTGGCAGCAACTCGAGTTGCTGCCAAATTGAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326016    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1250s21c1
Sequence:CCGGGCCTTCAGGGATATTCGTGAACTCGAGTTCACGAATATCCCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021388.3-1346s21c1
Sequence:CCGGGCAGAGATCCTACTGTATAAACTCGAGTTTATACAGTAGGATCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks