EMAIL THIS PAGE TO A FRIEND

EXTL3

exostosin-like glycosyltransferase 3

Synonyms: BOTV EXTL1L EXTR1 REGR RPR
UniProtKB ID: O43909, D3DST8, O00225, Q53XT3
Gene ID:
Human(2137) Summary: This gene encodes a single-pass membrane protein which functions as a glycosyltransferase. The encoded protein catalyzes the transfer of N-acetylglucosamine to glycosaminoglycan chains. This reaction is important in heparin and heparan sulfate synthesis. Alternative splicing results in the multiple transcript variants. [provided by RefSeq, Nov 2012]
Mouse(54616) exostoses (multiple)-like 3
Rat(56819) exostosin-like glycosyltransferase 3
Zebrafish(493783) exostoses (multiple)-like 3
chicken(422022) exostoses (multiple)-like 3
domestic cat(101095491) exostoses (multiple)-like 3
cow(783970) exostoses (multiple)-like 3
Horse(100054778) exostoses (multiple)-like 3
dog(486091) exostoses (multiple)-like 3
sheep(101108814) exostoses (multiple)-like 3
domestic guinea pig(100716129) exostosin-like glycosyltransferase 3
naked mole-rat(101697847) exostosin-like glycosyltransferase 3
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001440 Rosetta Predictions human pricing
NM_020097 Rosetta Predictions rat pricing
NM_018788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062625 predicted 596
2 SASI_Hs01_00062627 predicted 1432
3 SASI_Hs01_00062628 predicted 731
4 SASI_Hs01_00062629 predicted 1428
5 SASI_Hs01_00062630 predicted 1639
6 SASI_Hs01_00062631 predicted 1278
7 SASI_Hs02_00331847 predicted 1302
8 SASI_Hs01_00062633 predicted 2744
9 SASI_Hs01_00062634 predicted 1182
10 SASI_Hs02_00331848 predicted 1725
11 SASI_Hs01_00062626 predicted 2054
12 SASI_Hs01_00062632 predicted 1126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020097 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042064 predicted 1752
2 SASI_Rn01_00042065 predicted 1172
3 SASI_Rn01_00042066 predicted 1987
4 SASI_Rn01_00042067 predicted 610
5 SASI_Rn01_00042068 predicted 1038
6 SASI_Rn01_00042069 predicted 1045
7 SASI_Rn01_00042070 predicted 544
8 SASI_Rn01_00042071 predicted 2208
9 SASI_Rn01_00042072 predicted 341
10 SASI_Rn01_00042073 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00145806 predicted 551
2 SASI_Mm01_00145807 predicted 2902
3 SASI_Mm01_00145809 predicted 1152
4 SASI_Mm01_00145810 predicted 3209
5 SASI_Mm01_00145811 predicted 2305
6 SASI_Mm01_00145812 predicted 2705
7 SASI_Mm01_00145813 predicted 1688
8 SASI_Mm01_00145814 predicted 648
9 SASI_Mm01_00145815 predicted 890
10 SASI_Mm02_00324100 predicted 881
11 SASI_Mm01_00145808 predicted 2540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018788
VALIDATED
EXTL3 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3550s21c1
Sequence:CCGGACACTGAGGACTGTTCATAAGCTCGAGCTTATGAACAGTCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3178s21c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-1567s21c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-2147s21c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-1567s1c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2147s1c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2960s1c1
Sequence:CCGGGCCTTCTTTCACAAGTATTATCTCGAGATAATACTTGTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-3178s1c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018788
VALIDATED
EXTL3 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3550s21c1
Sequence:CCGGACACTGAGGACTGTTCATAAGCTCGAGCTTATGAACAGTCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3178s21c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-1567s21c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-2147s21c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-1567s1c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2147s1c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2960s1c1
Sequence:CCGGGCCTTCTTTCACAAGTATTATCTCGAGATAATACTTGTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-3178s1c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018788
VALIDATED
EXTL3 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3550s21c1
Sequence:CCGGACACTGAGGACTGTTCATAAGCTCGAGCTTATGAACAGTCCTCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-3178s21c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-1567s21c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_018788.2-2147s21c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-1567s1c1
Sequence:CCGGGCGGAAATATCTCTTCACTTTCTCGAGAAAGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2147s1c1
Sequence:CCGGGCCATGATTAGGACTCGAATTCTCGAGAATTCGAGTCCTAATCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-2960s1c1
Sequence:CCGGGCCTTCTTTCACAAGTATTATCTCGAGATAATACTTGTGAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018788.2-3178s1c1
Sequence:CCGGGCGGCACAAGTGTATCAACTTCTCGAGAAGTTGATACACTTGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001440
VALIDATED
EXTL3 MISSION shRNA Bacterial Glycerol Stock
exostosin-like glycosyltransferase 3
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-1607s21c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-3716s21c1
Sequence:CCGGTTGCCATTCAAGGCTTATTTACTCGAGTAAATAAGCCTTGAATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-2747s21c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-2057s21c1
Sequence:CCGGTCGTGTTACCGAGGTTCATTTCTCGAGAAATGAACCTCGGTAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-3326s21c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1127s1c1
Sequence:CCGGGCTACACAACTGCTTTGATTACTCGAGTAATCAAAGCAGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2762s1c1
Sequence:CCGGCAGTTTGAACAACCGATTCTTCTCGAGAAGAATCGGTTGTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-3062s1c1
Sequence:CCGGCATGGTGGATGAATACATCAACTCGAGTTGATGTATTCATCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2997s1c1
Sequence:CCGGGCTGCCTTCTTTCACAAGTATCTCGAGATACTTGTGAAAGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1010s1c1
Sequence:CCGGGCATTCCTACAAGGAGCTCATCTCGAGATGAGCTCCTTGTAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-2747s1c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-3326s1c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001440.2-1607s1c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001440
VALIDATED
EXTL3 MISSION shRNA shRNA Plasmid DNA
exostosin-like glycosyltransferase 3
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-1607s21c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-3716s21c1
Sequence:CCGGTTGCCATTCAAGGCTTATTTACTCGAGTAAATAAGCCTTGAATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-2747s21c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-2057s21c1
Sequence:CCGGTCGTGTTACCGAGGTTCATTTCTCGAGAAATGAACCTCGGTAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-3326s21c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1127s1c1
Sequence:CCGGGCTACACAACTGCTTTGATTACTCGAGTAATCAAAGCAGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2762s1c1
Sequence:CCGGCAGTTTGAACAACCGATTCTTCTCGAGAAGAATCGGTTGTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-3062s1c1
Sequence:CCGGCATGGTGGATGAATACATCAACTCGAGTTGATGTATTCATCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2997s1c1
Sequence:CCGGGCTGCCTTCTTTCACAAGTATCTCGAGATACTTGTGAAAGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1010s1c1
Sequence:CCGGGCATTCCTACAAGGAGCTCATCTCGAGATGAGCTCCTTGTAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-2747s1c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-3326s1c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001440.2-1607s1c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001440
VALIDATED
EXTL3 MISSION shRNA Lentiviral Transduction Particles
exostosin-like glycosyltransferase 3
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-1607s21c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323009    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-3716s21c1
Sequence:CCGGTTGCCATTCAAGGCTTATTTACTCGAGTAAATAAGCCTTGAATGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_001440.2-2747s21c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-2057s21c1
Sequence:CCGGTCGTGTTACCGAGGTTCATTTCTCGAGAAATGAACCTCGGTAACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001440.2-3326s21c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1127s1c1
Sequence:CCGGGCTACACAACTGCTTTGATTACTCGAGTAATCAAAGCAGTTGTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144438    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2762s1c1
Sequence:CCGGCAGTTTGAACAACCGATTCTTCTCGAGAAGAATCGGTTGTTCAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144207    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-3062s1c1
Sequence:CCGGCATGGTGGATGAATACATCAACTCGAGTTGATGTATTCATCCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001440.2-2997s1c1
Sequence:CCGGGCTGCCTTCTTTCACAAGTATCTCGAGATACTTGTGAAAGAAGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-1010s1c1
Sequence:CCGGGCATTCCTACAAGGAGCTCATCTCGAGATGAGCTCCTTGTAGGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-2747s1c1
Sequence:CCGGCCGTACTGAGAAGAACAGTTTCTCGAGAAACTGTTCTTCTCAGTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141559    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001440.2-3326s1c1
Sequence:CCGGCAAGACCAAGTGCTTCAAGTTCTCGAGAACTTGAAGCACTTGGTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_001440.2-1607s1c1
Sequence:CCGGGCGGAAATATCTCTTCACCTTCTCGAGAAGGTGAAGAGATATTTCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks