EMAIL THIS PAGE TO A FRIEND

EYA1

eyes absent homolog 1 (Drosophila)

179 Gene Product Result for
Synonyms: BOP BOR BOS1
UniProtKB ID: Q99502, A6NHQ0, G5E9R4, Q0P516, Q8WX80
Gene ID:
Human(2138) Summary: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Four transcript variants encoding three distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14048) eyes absent 1 homolog (Drosophila)
Rat(502935) eyes absent homolog 1 (Drosophila)
Zebrafish(30436) eyes absent homolog 1
chicken(395718) eyes absent homolog 1 (Drosophila)
dog(477910) eyes absent homolog 1 (Drosophila)
domestic cat(101098114) eyes absent homolog 1 (Drosophila)
Horse(100051446) eyes absent homolog 1 (Drosophila)
cow(511188) eyes absent homolog 1 (Drosophila)
sheep(101105259) eyes absent homolog 1 (Drosophila)
Domestic Rabbit(100338386) eyes absent homolog 1 (Drosophila)
naked mole-rat(101697803) eyes absent homolog 1 (Drosophila)
domestic guinea pig(100714546) eyes absent homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000503 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000503 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000503 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092131 MISSION® esiRNA esiRNA human EYA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000503 Rosetta Predictions human pricing
NM_172058 Rosetta Predictions human pricing
NM_172059 Rosetta Predictions human pricing
NM_172060 Rosetta Predictions human pricing
XM_001059758 Rosetta Predictions rat pricing
XM_578437 Rosetta Predictions rat pricing
NM_010164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236461 predicted 2660
2 SASI_Hs01_00236462 predicted 2608
3 SASI_Hs01_00236464 predicted 2661
4 SASI_Hs01_00236465 predicted 1301
5 SASI_Hs01_00236466 predicted 2281
6 SASI_Hs01_00236467 predicted 1275
7 SASI_Hs01_00236468 predicted 2177
8 SASI_Hs01_00236469 predicted 2655
9 SASI_Hs01_00236470 predicted 2095
10 SASI_Hs02_00302682 predicted 2604
11 SASI_Hs01_00236463 predicted 2253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172058 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026247 predicted 2305
2 SASI_Hs01_00026248 predicted 2257
3 SASI_Hs01_00026250 predicted 2305
4 SASI_Hs01_00026251 predicted 957
5 SASI_Hs01_00026252 predicted 1933
6 SASI_Hs01_00026253 predicted 926
7 SASI_Hs01_00026254 predicted 1820
8 SASI_Hs01_00026255 predicted 2303
9 SASI_Hs01_00026256 predicted 1747
10 SASI_Hs02_00367787 predicted 2244
11 SASI_Hs01_00026249 predicted 1796
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172059 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139373 predicted 2199
2 SASI_Hs01_00139374 predicted 2154
3 SASI_Hs01_00139376 predicted 2201
4 SASI_Hs01_00139377 predicted 938
5 SASI_Hs01_00139378 predicted 1819
6 SASI_Hs01_00139379 predicted 902
7 SASI_Hs01_00139380 predicted 1714
8 SASI_Hs01_00139381 predicted 2206
9 SASI_Hs01_00139382 predicted 1637
10 SASI_Hs02_00367788 predicted 2139
11 SASI_Hs01_00139375 predicted 1542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172060 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178885 predicted 2179
2 SASI_Hs01_00178886 predicted 2130
3 SASI_Hs01_00178888 predicted 2174
4 SASI_Hs01_00178889 predicted 826
5 SASI_Hs01_00178890 predicted 1796
6 SASI_Hs01_00178891 predicted 789
7 SASI_Hs01_00178892 predicted 1691
8 SASI_Hs01_00178893 predicted 2174
9 SASI_Hs01_00178894 predicted 1616
10 SASI_Hs02_00367789 predicted 2119
11 SASI_Hs01_00178887 predicted 1660
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294250 predicted 687
2 SASI_Rn02_00294251 predicted 588
3 SASI_Rn02_00294252 predicted 253
4 SASI_Rn02_00294253 predicted 1055
5 SASI_Rn02_00294254 predicted 393
6 SASI_Rn02_00294255 predicted 653
7 SASI_Rn02_00294256 predicted 331
8 SASI_Rn02_00294257 predicted 1432
9 SASI_Rn02_00294258 predicted 1447
10 SASI_Rn02_00294259 predicted 1368
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_578437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00407878 predicted 695
2 SASI_Rn02_00407879 predicted 591
3 SASI_Rn02_00407880 predicted 252
4 SASI_Rn02_00407881 predicted 1051
5 SASI_Rn02_00407882 predicted 395
6 SASI_Rn02_00407883 predicted 648
7 SASI_Rn02_00407884 predicted 328
8 SASI_Rn02_00407885 predicted 1429
9 SASI_Rn02_00407886 predicted 1445
10 SASI_Rn02_00407887 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110877 predicted 1542
2 SASI_Mm01_00110878 predicted 2336
3 SASI_Mm02_00317929 predicted 744
4 SASI_Mm01_00110879 predicted 2145
5 SASI_Mm01_00110880 predicted 1303
6 SASI_Mm01_00110881 predicted 1010
7 SASI_Mm01_00110883 predicted 862
8 SASI_Mm01_00110884 predicted 620
9 SASI_Mm01_00110885 predicted 1142
10 SASI_Mm01_00110886 predicted 1345
11 SASI_Mm01_00110882 predicted 2234
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000503
VALIDATED
EYA1 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-3547s1c1
Sequence:CCGGCCCACAAAGAATATAGATGATCTCGAGATCATCTATATTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-1560s1c1
Sequence:CCGGGCCGAAGAAACAATAATCCTTCTCGAGAAGGATTATTGTTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-811s1c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2114s1c1
Sequence:CCGGCGGACAAACTGTGTGAATATTCTCGAGAATATTCACACAGTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2112s1c1
Sequence:CCGGCCCGGACAAACTGTGTGAATACTCGAGTATTCACACAGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-1484s21c1
Sequence:CCGGAGCCCATCAACACCCATTAAACTCGAGTTTAATGGGTGTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-748s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-2034s21c1
Sequence:CCGGTGCAGTTGAGGGCCGAAATTGCTCGAGCAATTTCGGCCCTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000503.4-2572s21c1
Sequence:CCGGGAATGGAGGACCACGTCTATTCTCGAGAATAGACGTGGTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-811s21c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-1875s21c1
Sequence:CCGGCAGCAACCAGTGCTAACTTATCTCGAGATAAGTTAGCACTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000503
VALIDATED
EYA1 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-3547s1c1
Sequence:CCGGCCCACAAAGAATATAGATGATCTCGAGATCATCTATATTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-1560s1c1
Sequence:CCGGGCCGAAGAAACAATAATCCTTCTCGAGAAGGATTATTGTTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-811s1c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2114s1c1
Sequence:CCGGCGGACAAACTGTGTGAATATTCTCGAGAATATTCACACAGTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2112s1c1
Sequence:CCGGCCCGGACAAACTGTGTGAATACTCGAGTATTCACACAGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-1484s21c1
Sequence:CCGGAGCCCATCAACACCCATTAAACTCGAGTTTAATGGGTGTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-748s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-2034s21c1
Sequence:CCGGTGCAGTTGAGGGCCGAAATTGCTCGAGCAATTTCGGCCCTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000503.4-2572s21c1
Sequence:CCGGGAATGGAGGACCACGTCTATTCTCGAGAATAGACGTGGTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-811s21c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-1875s21c1
Sequence:CCGGCAGCAACCAGTGCTAACTTATCTCGAGATAAGTTAGCACTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000503
VALIDATED
EYA1 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 1 (Drosophila)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083443    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-3547s1c1
Sequence:CCGGCCCACAAAGAATATAGATGATCTCGAGATCATCTATATTCTTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-1560s1c1
Sequence:CCGGGCCGAAGAAACAATAATCCTTCTCGAGAAGGATTATTGTTTCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083446    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000503.3-811s1c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2114s1c1
Sequence:CCGGCGGACAAACTGTGTGAATATTCTCGAGAATATTCACACAGTTTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000503.3-2112s1c1
Sequence:CCGGCCCGGACAAACTGTGTGAATACTCGAGTATTCACACAGTTTGTCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-1484s21c1
Sequence:CCGGAGCCCATCAACACCCATTAAACTCGAGTTTAATGGGTGTTGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-748s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000503.4-2034s21c1
Sequence:CCGGTGCAGTTGAGGGCCGAAATTGCTCGAGCAATTTCGGCCCTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000503.4-2572s21c1
Sequence:CCGGGAATGGAGGACCACGTCTATTCTCGAGAATAGACGTGGTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-811s21c1
Sequence:CCGGCGACGGGTCTTTAAACAATTTCTCGAGAAATTGTTTAAAGACCCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000503.4-1875s21c1
Sequence:CCGGCAGCAACCAGTGCTAACTTATCTCGAGATAAGTTAGCACTGGTTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010164
VALIDATED
EYA1 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-2020s1c1
Sequence:CCGGGATGTACCAATTTCAGCATATCTCGAGATATGCTGAAATTGGTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-1623s1c1
Sequence:CCGGCCGGACGAACTGTGTGAATATCTCGAGATATTCACACAGTTCGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-719s1c1
Sequence:CCGGCCACGTCATCAGGATTATATTCTCGAGAATATAATCCTGATGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-221s1c1
Sequence:CCGGCCAAACTCGATAGCTCTCATACTCGAGTATGAGAGCTATCGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-455s1c1
Sequence:CCGGCCTCACAAACTATGGCTGCATCTCGAGATGCAGCCATAGTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-771s21c1
Sequence:CCGGACAGCAGCAGACGGGTCTTTACTCGAGTAAAGACCCGTCTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-716s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2687s21c1
Sequence:CCGGTTCGGCAAATGTGATACAAACCTCGAGGTTTGTATCACATTTGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1437s21c1
Sequence:CCGGAGTCCTTCCACACCCATTAAACTCGAGTTTAATGGGTGTGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1161s21c1
Sequence:CCGGACCACGTCATCAGGATTATATCTCGAGATATAATCCTGATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2828s21c1
Sequence:CCGGTCTGTACTTCGCTACTTATTTCTCGAGAAATAAGTAGCGAAGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1898s21c1
Sequence:CCGGCTTCCGCTACAGACGAGTAAACTCGAGTTTACTCGTCTGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1826s21c1
Sequence:CCGGTGCAGCCACCAGTGCTAATTTCTCGAGAAATTAGCACTGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010164
VALIDATED
EYA1 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-2020s1c1
Sequence:CCGGGATGTACCAATTTCAGCATATCTCGAGATATGCTGAAATTGGTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-1623s1c1
Sequence:CCGGCCGGACGAACTGTGTGAATATCTCGAGATATTCACACAGTTCGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-719s1c1
Sequence:CCGGCCACGTCATCAGGATTATATTCTCGAGAATATAATCCTGATGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-221s1c1
Sequence:CCGGCCAAACTCGATAGCTCTCATACTCGAGTATGAGAGCTATCGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-455s1c1
Sequence:CCGGCCTCACAAACTATGGCTGCATCTCGAGATGCAGCCATAGTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-771s21c1
Sequence:CCGGACAGCAGCAGACGGGTCTTTACTCGAGTAAAGACCCGTCTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-716s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2687s21c1
Sequence:CCGGTTCGGCAAATGTGATACAAACCTCGAGGTTTGTATCACATTTGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1437s21c1
Sequence:CCGGAGTCCTTCCACACCCATTAAACTCGAGTTTAATGGGTGTGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1161s21c1
Sequence:CCGGACCACGTCATCAGGATTATATCTCGAGATATAATCCTGATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2828s21c1
Sequence:CCGGTCTGTACTTCGCTACTTATTTCTCGAGAAATAAGTAGCGAAGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1898s21c1
Sequence:CCGGCTTCCGCTACAGACGAGTAAACTCGAGTTTACTCGTCTGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1826s21c1
Sequence:CCGGTGCAGCCACCAGTGCTAATTTCTCGAGAAATTAGCACTGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010164
VALIDATED
EYA1 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 1 (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029844    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-2020s1c1
Sequence:CCGGGATGTACCAATTTCAGCATATCTCGAGATATGCTGAAATTGGTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-1623s1c1
Sequence:CCGGCCGGACGAACTGTGTGAATATCTCGAGATATTCACACAGTTCGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029847    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-719s1c1
Sequence:CCGGCCACGTCATCAGGATTATATTCTCGAGAATATAATCCTGATGACGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_010164.1-221s1c1
Sequence:CCGGCCAAACTCGATAGCTCTCATACTCGAGTATGAGAGCTATCGAGTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010164.1-455s1c1
Sequence:CCGGCCTCACAAACTATGGCTGCATCTCGAGATGCAGCCATAGTTTGTGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-771s21c1
Sequence:CCGGACAGCAGCAGACGGGTCTTTACTCGAGTAAAGACCCGTCTGCTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366189    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-716s21c1
Sequence:CCGGTCCCAATGGCACCGAAGTTAACTCGAGTTAACTTCGGTGCCATTGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374711    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2687s21c1
Sequence:CCGGTTCGGCAAATGTGATACAAACCTCGAGGTTTGTATCACATTTGCCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366228    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1437s21c1
Sequence:CCGGAGTCCTTCCACACCCATTAAACTCGAGTTTAATGGGTGTGGAAGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1161s21c1
Sequence:CCGGACCACGTCATCAGGATTATATCTCGAGATATAATCCTGATGACGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010164.2-2828s21c1
Sequence:CCGGTCTGTACTTCGCTACTTATTTCTCGAGAAATAAGTAGCGAAGTACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1898s21c1
Sequence:CCGGCTTCCGCTACAGACGAGTAAACTCGAGTTTACTCGTCTGTAGCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010164.2-1826s21c1
Sequence:CCGGTGCAGCCACCAGTGCTAATTTCTCGAGAAATTAGCACTGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks