EMAIL THIS PAGE TO A FRIEND

EYA2

eyes absent homolog 2 (Drosophila)

110 Gene Product Result for
Synonyms: EAB1
Gene ID:
Human(2139) Summary: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may be post-translationally modified and may play a role in eye development. A similar protein in mice can act as a transcriptional activator. Alternative splicing results in multiple transcript variants, but the full-length natures of all of these variants have not yet been determined. [provided by RefSeq, Jul 2009]
Mouse(14049) eyes absent 2 homolog (Drosophila)
Rat(156826) eyes absent homolog 2 (Drosophila)
domestic guinea pig(100731548) eyes absent homolog 2 (Drosophila)
naked mole-rat(101711844) eyes absent homolog 2 (Drosophila)
sheep(101118806) eyes absent homolog 2 (Drosophila)
Zebrafish(447819) eyes absent homolog 2 (Drosophila)
domestic cat(101083833) eyes absent homolog 2 (Drosophila)
cow(615264) eyes absent homolog 2 (Drosophila)
Horse(100071250) eyes absent homolog 2 (Drosophila)
dog(609926) eyes absent homolog 2 (Drosophila)
chicken(395745) eyes absent homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010165 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010165 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010165 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005244 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005244 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005244 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU086961 MISSION® esiRNA esiRNA human EYA2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005244 Rosetta Predictions human pricing
NM_172110 Rosetta Predictions human pricing
NM_172111 Rosetta Predictions human pricing
NM_172112 Rosetta Predictions human pricing
NM_172113 Rosetta Predictions human pricing
NM_130427 Rosetta Predictions rat pricing
NM_010165 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005244 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339254 predicted 1070
2 SASI_Hs01_00239832 predicted 1319
3 SASI_Hs01_00239833 predicted 1121
4 SASI_Hs02_00339255 predicted 1068
5 SASI_Hs01_00239835 predicted 1060
6 SASI_Hs01_00239836 predicted 1150
7 SASI_Hs01_00239837 predicted 877
8 SASI_Hs01_00239838 predicted 924
9 SASI_Hs01_00239839 predicted 1287
10 SASI_Hs01_00239840 predicted 801
11 SASI_Hs01_00239834 predicted 1519
12 SASI_Hs01_00239841 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172110 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367834 predicted 1000
2 SASI_Hs01_00105455 predicted 1249
3 SASI_Hs01_00105456 predicted 1043
4 SASI_Hs02_00367835 predicted 997
5 SASI_Hs01_00105458 predicted 990
6 SASI_Hs01_00105459 predicted 1085
7 SASI_Hs01_00105460 predicted 805
8 SASI_Hs01_00105461 predicted 855
9 SASI_Hs01_00105462 predicted 1211
10 SASI_Hs01_00105463 predicted 726
11 SASI_Hs01_00105457 predicted 1448
12 SASI_Hs01_00105464 predicted 1254
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172111 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367836 predicted 1097
2 SASI_Hs01_00103834 predicted 1354
3 SASI_Hs01_00103835 predicted 1148
4 SASI_Hs02_00367837 predicted 1103
5 SASI_Hs01_00103837 predicted 1085
6 SASI_Hs01_00103838 predicted 1178
7 SASI_Hs01_00103839 predicted 911
8 SASI_Hs01_00103840 predicted 960
9 SASI_Hs01_00103841 predicted 1313
10 SASI_Hs01_00103842 predicted 833
11 SASI_Hs01_00103836 predicted 1555
12 SASI_Hs01_00103843 predicted 1353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172112 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367838 predicted 1050
2 SASI_Hs01_00043939 predicted 1300
3 SASI_Hs01_00043940 predicted 1102
4 SASI_Hs02_00367839 predicted 1053
5 SASI_Hs01_00043942 predicted 1035
6 SASI_Hs01_00043943 predicted 1134
7 SASI_Hs01_00043944 predicted 861
8 SASI_Hs01_00043945 predicted 913
9 SASI_Hs01_00043946 predicted 1268
10 SASI_Hs01_00043947 predicted 782
11 SASI_Hs01_00043941 predicted 1499
12 SASI_Hs01_00043948 predicted 1305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367840 predicted 1359
2 SASI_Hs01_00196931 predicted 1609
3 SASI_Hs01_00196932 predicted 1402
4 SASI_Hs02_00367841 predicted 1349
5 SASI_Hs01_00196934 predicted 1340
6 SASI_Hs01_00196935 predicted 1433
7 SASI_Hs01_00196936 predicted 1157
8 SASI_Hs01_00196937 predicted 1217
9 SASI_Hs01_00196938 predicted 1571
10 SASI_Hs01_00196939 predicted 1085
11 SASI_Hs01_00196933 predicted 1809
12 SASI_Hs01_00196940 predicted 1607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085855 predicted 285
2 SASI_Rn01_00085856 predicted 602
3 SASI_Rn01_00085857 predicted 977
4 SASI_Rn01_00085858 predicted 1062
5 SASI_Rn01_00085859 predicted 1282
6 SASI_Rn01_00085860 predicted 1329
7 SASI_Rn01_00085861 predicted 923
8 SASI_Rn01_00085862 predicted 635
9 SASI_Rn02_00267437 predicted 626
10 SASI_Rn02_00267438 predicted 1300
11 SASI_Rn01_00085854 predicted 1177
12 SASI_Rn01_00085863 predicted 1277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010165 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144444 predicted 1378
2 SASI_Mm01_00144445 predicted 471
3 SASI_Mm01_00144446 predicted 1223
4 SASI_Mm01_00144447 predicted 346
5 SASI_Mm01_00144448 predicted 755
6 SASI_Mm01_00144449 predicted 1420
7 SASI_Mm01_00144450 predicted 1163
8 SASI_Mm01_00144451 predicted 1256
9 SASI_Mm01_00144452 predicted 1547
10 SASI_Mm01_00144453 predicted 1263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010165
EYA2 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-890s1c1
Sequence:CCGGCGGAGACTACAACACACACAACTCGAGTTGTGTGTGTTGTAGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010165.1-1969s1c1
Sequence:CCGGCCATTTCAGAAGTGTCTTCTTCTCGAGAAGAAGACACTTCTGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-755s1c1
Sequence:CCGGCCAGTATTTCAGCCCATCATACTCGAGTATGATGGGCTGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1825s1c1
Sequence:CCGGCCCTGGAACTGGAGTATCTATCTCGAGATAGATACTCCAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1682s1c1
Sequence:CCGGCGAAAGAATCATGCAGAGGTTCTCGAGAACCTCTGCATGATTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010165
EYA2 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-890s1c1
Sequence:CCGGCGGAGACTACAACACACACAACTCGAGTTGTGTGTGTTGTAGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010165.1-1969s1c1
Sequence:CCGGCCATTTCAGAAGTGTCTTCTTCTCGAGAAGAAGACACTTCTGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-755s1c1
Sequence:CCGGCCAGTATTTCAGCCCATCATACTCGAGTATGATGGGCTGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1825s1c1
Sequence:CCGGCCCTGGAACTGGAGTATCTATCTCGAGATAGATACTCCAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1682s1c1
Sequence:CCGGCGAAAGAATCATGCAGAGGTTCTCGAGAACCTCTGCATGATTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010165
EYA2 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-890s1c1
Sequence:CCGGCGGAGACTACAACACACACAACTCGAGTTGTGTGTGTTGTAGTCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029849    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010165.1-1969s1c1
Sequence:CCGGCCATTTCAGAAGTGTCTTCTTCTCGAGAAGAAGACACTTCTGAAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-755s1c1
Sequence:CCGGCCAGTATTTCAGCCCATCATACTCGAGTATGATGGGCTGAAATACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1825s1c1
Sequence:CCGGCCCTGGAACTGGAGTATCTATCTCGAGATAGATACTCCAGTTCCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010165.1-1682s1c1
Sequence:CCGGCGAAAGAATCATGCAGAGGTTCTCGAGAACCTCTGCATGATTCTTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005244
EYA2 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 2 (Drosophila)
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000051946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-175s1c1
Sequence:CCGGGTCTGGATAAACTGAAGTTTACTCGAGTAAACTTCAGTTTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-776s1c1
Sequence:CCGGCGAGTCACTTGCTGGTGAATACTCGAGTATTCACCAGCAAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005244
EYA2 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 2 (Drosophila)
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000051946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-175s1c1
Sequence:CCGGGTCTGGATAAACTGAAGTTTACTCGAGTAAACTTCAGTTTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-776s1c1
Sequence:CCGGCGAGTCACTTGCTGGTGAATACTCGAGTATTCACCAGCAAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005244
EYA2 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 2 (Drosophila)
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000051946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-175s1c1
Sequence:CCGGGTCTGGATAAACTGAAGTTTACTCGAGTAAACTTCAGTTTATCCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005244.3-776s1c1
Sequence:CCGGCGAGTCACTTGCTGGTGAATACTCGAGTATTCACCAGCAAGTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks