EMAIL THIS PAGE TO A FRIEND

EYA3

eyes absent homolog 3 (Drosophila)

UniProtKB ID: Q99504, A8K190, O95463, Q99813
Gene ID:
Human(2140) Summary: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. A similar protein in mice acts as a transcriptional activator. [provided by RefSeq, Jul 2008]
Mouse(14050) eyes absent 3 homolog (Drosophila)
Rat(313027) eyes absent homolog 3 (Drosophila)
Zebrafish(571385) eyes absent homolog 3
cow(514364) eyes absent homolog 3 (Drosophila)
Horse(100070791) eyes absent homolog 3 (Drosophila)
domestic cat(101085482) eyes absent homolog 3 (Drosophila)
dog(610061) eyes absent homolog 3 (Drosophila)
chicken(395717) eyes absent homolog 3 (Drosophila)
sheep(100271658) eyes absent homolog 3 (Drosophila)
Domestic Rabbit(100354296) eyes absent homolog 3 (Drosophila)
naked mole-rat(101710091) eyes absent homolog 3 (Drosophila)
domestic guinea pig(100720978) eyes absent homolog 3 (Drosophila)
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001990 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010166 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010166 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010166 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001990 Rosetta Predictions human pricing
NM_001107910 Rosetta Predictions rat pricing
NM_010166 Rosetta Predictions mouse pricing
NM_210071 Rosetta Predictions mouse pricing
NM_211357 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039975 predicted 678
2 SASI_Hs02_00332976 predicted 1277
3 SASI_Hs01_00039977 predicted 335
4 SASI_Hs01_00039978 predicted 937
5 SASI_Hs01_00039979 predicted 637
6 SASI_Hs01_00039980 predicted 750
7 SASI_Hs01_00039981 predicted 1294
8 SASI_Hs01_00039982 predicted 360
9 SASI_Hs01_00039984 predicted 249
10 SASI_Hs02_00332977 predicted 523
11 SASI_Hs01_00039976 predicted 1749
12 SASI_Hs01_00039983 predicted 1549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107910 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233485 predicted 374
2 SASI_Rn02_00233486 predicted 1519
3 SASI_Rn02_00233487 predicted 932
4 SASI_Rn02_00233488 predicted 347
5 SASI_Rn02_00233489 predicted 1462
6 SASI_Rn02_00233490 predicted 1533
7 SASI_Rn02_00233491 predicted 443
8 SASI_Rn02_00233492 predicted 510
9 SASI_Rn02_00233493 predicted 368
10 SASI_Rn02_00233494 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010166 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140287 predicted 1550
2 SASI_Mm02_00317930 predicted 1185
3 SASI_Mm01_00140288 predicted 963
4 SASI_Mm01_00140289 predicted 1061
5 SASI_Mm02_00317931 predicted 1649
6 SASI_Mm01_00140291 predicted 957
7 SASI_Mm01_00140293 predicted 1654
8 SASI_Mm01_00140294 predicted 1203
9 SASI_Mm01_00140295 predicted 761
10 SASI_Mm01_00140296 predicted 988
11 SASI_Mm01_00140290 predicted 1825
12 SASI_Mm01_00140292 predicted 1649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_210071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023487 predicted 1522
2 SASI_Mm02_00352248 predicted 1159
3 SASI_Mm01_00023488 predicted 934
4 SASI_Mm01_00023489 predicted 1032
5 SASI_Mm02_00352249 predicted 1618
6 SASI_Mm01_00023491 predicted 924
7 SASI_Mm01_00023493 predicted 1630
8 SASI_Mm01_00023494 predicted 1170
9 SASI_Mm01_00023495 predicted 735
10 SASI_Mm01_00023496 predicted 956
11 SASI_Mm01_00023490 predicted 1787
12 SASI_Mm01_00023492 predicted 1620
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_211357 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023467 predicted 1338
2 SASI_Mm02_00352251 predicted 981
3 SASI_Mm01_00023468 predicted 759
4 SASI_Mm01_00023469 predicted 847
5 SASI_Mm02_00352252 predicted 1439
6 SASI_Mm01_00023471 predicted 747
7 SASI_Mm01_00023473 predicted 1444
8 SASI_Mm01_00023474 predicted 987
9 SASI_Mm01_00023475 predicted 548
10 SASI_Mm01_00023476 predicted 775
11 SASI_Mm01_00023470 predicted 1608
12 SASI_Mm01_00023472 predicted 1439
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001990
EYA3 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-939s1c1
Sequence:CCGGCCCTTCTACAAGTCCATCTTTCTCGAGAAAGATGGACTTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1538s1c1
Sequence:CCGGCCTGGTTAGGAACTGCATTAACTCGAGTTAATGCAGTTCCTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1860s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGATTTCTCGAGAAATCAAGCTCTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-640s1c1
Sequence:CCGGGCACATTATTCTTATCCCATTCTCGAGAATGGGATAAGAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1422s1c1
Sequence:CCGGCCGGAAAGTGAGAGAAATCTACTCGAGTAGATTTCTCTCACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001990
EYA3 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-939s1c1
Sequence:CCGGCCCTTCTACAAGTCCATCTTTCTCGAGAAAGATGGACTTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1538s1c1
Sequence:CCGGCCTGGTTAGGAACTGCATTAACTCGAGTTAATGCAGTTCCTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1860s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGATTTCTCGAGAAATCAAGCTCTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-640s1c1
Sequence:CCGGGCACATTATTCTTATCCCATTCTCGAGAATGGGATAAGAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1422s1c1
Sequence:CCGGCCGGAAAGTGAGAGAAATCTACTCGAGTAGATTTCTCTCACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001990
EYA3 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 3 (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-939s1c1
Sequence:CCGGCCCTTCTACAAGTCCATCTTTCTCGAGAAAGATGGACTTGTAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1538s1c1
Sequence:CCGGCCTGGTTAGGAACTGCATTAACTCGAGTTAATGCAGTTCCTAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1860s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGATTTCTCGAGAAATCAAGCTCTAAAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-640s1c1
Sequence:CCGGGCACATTATTCTTATCCCATTCTCGAGAATGGGATAAGAATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001990.2-1422s1c1
Sequence:CCGGCCGGAAAGTGAGAGAAATCTACTCGAGTAGATTTCTCTCACTTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010166
VALIDATED
EYA3 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010166.2-4122s1c1
Sequence:CCGGCGTGTAAGAAACACTCATAAACTCGAGTTTATGAGTGTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-750s1c1
Sequence:CCGGCCACAACATTAGCAGCTACAACTCGAGTTGTAGCTGCTAATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-382s1c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010166.2-1756s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGACTTCTCGAGAAGTCAAGCTCTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-393s1c1
Sequence:CCGGCCAATGATTATACCTCACAAACTCGAGTTTGTGAGGTATAATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-320s21c1
Sequence:CCGGACATCCAGCCTTGCGTCAAATCTCGAGATTTGACGCAAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-650s21c1
Sequence:CCGGGATTATCCCACCTATACTATTCTCGAGAATAGTATAGGTGGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-959s21c1
Sequence:CCGGAGTGAATTGGAACGGGTATTTCTCGAGAAATACCCGTTCCAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-382s21c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010166
VALIDATED
EYA3 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010166.2-4122s1c1
Sequence:CCGGCGTGTAAGAAACACTCATAAACTCGAGTTTATGAGTGTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-750s1c1
Sequence:CCGGCCACAACATTAGCAGCTACAACTCGAGTTGTAGCTGCTAATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-382s1c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010166.2-1756s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGACTTCTCGAGAAGTCAAGCTCTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-393s1c1
Sequence:CCGGCCAATGATTATACCTCACAAACTCGAGTTTGTGAGGTATAATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-320s21c1
Sequence:CCGGACATCCAGCCTTGCGTCAAATCTCGAGATTTGACGCAAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-650s21c1
Sequence:CCGGGATTATCCCACCTATACTATTCTCGAGAATAGTATAGGTGGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-959s21c1
Sequence:CCGGAGTGAATTGGAACGGGTATTTCTCGAGAAATACCCGTTCCAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-382s21c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010166
VALIDATED
EYA3 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 3 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029854    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010166.2-4122s1c1
Sequence:CCGGCGTGTAAGAAACACTCATAAACTCGAGTTTATGAGTGTTTCTTACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-750s1c1
Sequence:CCGGCCACAACATTAGCAGCTACAACTCGAGTTGTAGCTGCTAATGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-382s1c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010166.2-1756s1c1
Sequence:CCGGCCAGGCTTTAGAGCTTGACTTCTCGAGAAGTCAAGCTCTAAAGCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010166.2-393s1c1
Sequence:CCGGCCAATGATTATACCTCACAAACTCGAGTTTGTGAGGTATAATCATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-320s21c1
Sequence:CCGGACATCCAGCCTTGCGTCAAATCTCGAGATTTGACGCAAGGCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-650s21c1
Sequence:CCGGGATTATCCCACCTATACTATTCTCGAGAATAGTATAGGTGGGATAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-959s21c1
Sequence:CCGGAGTGAATTGGAACGGGTATTTCTCGAGAAATACCCGTTCCAATTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010166.2-382s21c1
Sequence:CCGGCCCTCGCTCATCCAATGATTACTCGAGTAATCATTGGATGAGCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks