EMAIL THIS PAGE TO A FRIEND

EYA4

eyes absent homolog 4 (Drosophila)

Synonyms: CMD1J DFNA10
UniProtKB ID: O95677, B7Z7F7, O95464, O95679, Q8IW39, Q9NTR7
Gene ID:
Human(2070) Summary: This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator through its protein phosphatase activity, and it may be important for eye development, and for continued function of the mature organ of Corti. Mutations in this gene are associated with postlingual, progressive, autosomal dominant hearing loss at the deafness, autosomal dominant nonsyndromic sensorineural 10 locus. Defects in this gene are also associated with dilated cardiomyopathy 1J. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(14051) eyes absent 4 homolog (Drosophila)
Rat(292172) eyes absent homolog 4 (Drosophila)
domestic guinea pig(100730056) eyes absent homolog 4 (Drosophila)
naked mole-rat(101711766) eyes absent homolog 4 (Drosophila)
sheep(101106335) eyes absent homolog 4 (Drosophila)
Zebrafish(541552) eyes absent homolog 4 (Drosophila)
cow(538786) eyes absent homolog 4 (Drosophila)
Horse(100067710) eyes absent homolog 4 (Drosophila)
domestic cat(101097975) eyes absent homolog 4 (Drosophila)
dog(483991) eyes absent homolog 4 (Drosophila)
chicken(395716) eyes absent homolog 4 (Drosophila)
308 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010167 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010167 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010167 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004100 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004100 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004100 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004100 Rosetta Predictions human pricing
NM_172103 Rosetta Predictions human pricing
NM_172105 Rosetta Predictions human pricing
XM_001054107 Rosetta Predictions rat pricing
XM_001054174 Rosetta Predictions rat pricing
XM_001054236 Rosetta Predictions rat pricing
XM_001054306 Rosetta Predictions rat pricing
XM_001054371 Rosetta Predictions rat pricing
XM_001054426 Rosetta Predictions rat pricing
XM_001054483 Rosetta Predictions rat pricing
XM_217715 Rosetta Predictions rat pricing
NM_010167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004100 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149208 predicted 1732
2 SASI_Hs01_00149209 predicted 1032
3 SASI_Hs01_00149210 predicted 1171
4 SASI_Hs01_00149211 predicted 1289
5 SASI_Hs01_00149212 predicted 1314
6 SASI_Hs01_00149214 predicted 1268
7 SASI_Hs02_00336912 predicted 1563
8 SASI_Hs01_00149215 predicted 1621
9 SASI_Hs01_00149216 predicted 1254
10 SASI_Hs02_00336913 predicted 1318
11 SASI_Hs01_00149207 predicted 1484
12 SASI_Hs01_00149213 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172103 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171231 predicted 1670
2 SASI_Hs01_00171232 predicted 954
3 SASI_Hs01_00171233 predicted 1098
4 SASI_Hs01_00171234 predicted 1227
5 SASI_Hs01_00171235 predicted 1239
6 SASI_Hs01_00171237 predicted 1195
7 SASI_Hs02_00367826 predicted 1492
8 SASI_Hs01_00171238 predicted 1553
9 SASI_Hs01_00171239 predicted 1190
10 SASI_Hs02_00367827 predicted 1247
11 SASI_Hs01_00171230 predicted 1407
12 SASI_Hs01_00171236 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172105 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221363 predicted 1737
2 SASI_Hs01_00221364 predicted 1029
3 SASI_Hs01_00221365 predicted 1163
4 SASI_Hs01_00221366 predicted 1292
5 SASI_Hs01_00221367 predicted 1311
6 SASI_Hs01_00221369 predicted 1272
7 SASI_Hs02_00367828 predicted 1566
8 SASI_Hs01_00221370 predicted 1614
9 SASI_Hs01_00221371 predicted 1258
10 SASI_Hs02_00367829 predicted 1317
11 SASI_Hs01_00221362 predicted 1475
12 SASI_Hs01_00221368 predicted 1048
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054107 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274768 predicted 867
2 SASI_Rn02_00274769 predicted 671
3 SASI_Rn02_00274770 predicted 538
4 SASI_Rn02_00274771 predicted 842
5 SASI_Rn02_00274772 predicted 1325
6 SASI_Rn02_00274773 predicted 746
7 SASI_Rn02_00274774 predicted 1376
8 SASI_Rn02_00274775 predicted 345
9 SASI_Rn02_00274776 predicted 576
10 SASI_Rn02_00274777 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054174 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274977 predicted 885
2 SASI_Rn02_00274978 predicted 692
3 SASI_Rn02_00274979 predicted 1143
4 SASI_Rn02_00274980 predicted 565
5 SASI_Rn02_00274981 predicted 869
6 SASI_Rn02_00274982 predicted 1441
7 SASI_Rn02_00274983 predicted 1103
8 SASI_Rn02_00274984 predicted 1487
9 SASI_Rn02_00274985 predicted 350
10 SASI_Rn02_00274986 predicted 598
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275194 predicted 867
2 SASI_Rn02_00275195 predicted 672
3 SASI_Rn02_00275196 predicted 1123
4 SASI_Rn02_00275197 predicted 539
5 SASI_Rn02_00275198 predicted 847
6 SASI_Rn02_00275199 predicted 1414
7 SASI_Rn02_00275200 predicted 1082
8 SASI_Rn02_00275201 predicted 1468
9 SASI_Rn02_00275202 predicted 343
10 SASI_Rn02_00275203 predicted 575
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054306 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275417 predicted 1159
2 SASI_Rn02_00275418 predicted 1414
3 SASI_Rn02_00275419 predicted 850
4 SASI_Rn02_00275420 predicted 1138
5 SASI_Rn02_00275421 predicted 1711
6 SASI_Rn02_00275422 predicted 1371
7 SASI_Rn02_00275423 predicted 1757
8 SASI_Rn02_00275424 predicted 629
9 SASI_Rn02_00275425 predicted 877
10 SASI_Rn02_00275426 predicted 1404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275618 predicted 883
2 SASI_Rn02_00275619 predicted 695
3 SASI_Rn02_00275620 predicted 1143
4 SASI_Rn02_00275621 predicted 557
5 SASI_Rn02_00275622 predicted 864
6 SASI_Rn02_00275623 predicted 1433
7 SASI_Rn02_00275624 predicted 1096
8 SASI_Rn02_00275625 predicted 1489
9 SASI_Rn02_00275626 predicted 339
10 SASI_Rn02_00275627 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054426 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275735 predicted 1264
2 SASI_Rn02_00275736 predicted 1528
3 SASI_Rn02_00275737 predicted 960
4 SASI_Rn02_00275738 predicted 1248
5 SASI_Rn02_00275739 predicted 1820
6 SASI_Rn02_00275740 predicted 1485
7 SASI_Rn02_00275741 predicted 1870
8 SASI_Rn02_00275742 predicted 747
9 SASI_Rn02_00275743 predicted 993
10 SASI_Rn02_00275744 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054483 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00275958 predicted 862
2 SASI_Rn02_00275959 predicted 691
3 SASI_Rn02_00275960 predicted 1127
4 SASI_Rn02_00275961 predicted 554
5 SASI_Rn02_00275962 predicted 844
6 SASI_Rn02_00275963 predicted 1415
7 SASI_Rn02_00275964 predicted 1080
8 SASI_Rn02_00275965 predicted 1468
9 SASI_Rn02_00275966 predicted 339
10 SASI_Rn02_00275967 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377317 predicted 420
2 SASI_Rn02_00377318 predicted 299
3 SASI_Rn02_00377319 predicted 590
4 SASI_Rn02_00377320 predicted 957
5 SASI_Rn02_00377321 predicted 351
6 SASI_Rn02_00377322 predicted 2253
7 SASI_Rn02_00377323 predicted 744
8 SASI_Rn02_00377324 predicted 2303
9 SASI_Rn02_00377325 predicted 1175
10 SASI_Rn02_00377326 predicted 886
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00177724 predicted 1436
2 SASI_Mm01_00177725 predicted 1878
3 SASI_Mm01_00177727 predicted 1414
4 SASI_Mm01_00177728 predicted 2151
5 SASI_Mm01_00177729 predicted 1896
6 SASI_Mm01_00177730 predicted 1527
7 SASI_Mm01_00177731 predicted 1453
8 SASI_Mm01_00177732 predicted 1761
9 SASI_Mm01_00177733 predicted 602
10 SASI_Mm02_00317932 predicted 1706
11 SASI_Mm01_00177726 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010167
EYA4 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 4 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2250s21c1
Sequence:CCGGGAAGCTCTATGGTCTTATTATCTCGAGATAATAAGACCATAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2538s21c1
Sequence:CCGGCAGTCCTATCTAGACCTATAACTCGAGTTATAGGTCTAGATAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2136s21c1
Sequence:CCGGGGCTTCTTCTACACATATTAACTCGAGTTAATATGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010167.4-1446s21c1
Sequence:CCGGATGTTTCCTCCGACGACAATGCTCGAGCATTGTCGTCGGAGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010167.2-3132s1c1
Sequence:CCGGGCCATGTTCATATCAACATATCTCGAGATATGTTGATATGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1896s1c1
Sequence:CCGGGAGCGAATAATGCAAAGGTTTCTCGAGAAACCTTTGCATTATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1362s1c1
Sequence:CCGGCGGATGGAAGAAATGATCTTTCTCGAGAAAGATCATTTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1699s1c1
Sequence:CCGGGCCTAACAGATTCCTGGCTAACTCGAGTTAGCCAGGAATCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-609s1c1
Sequence:CCGGGCTCAAACAATGTCGGCCTATCTCGAGATAGGCCGACATTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010167
EYA4 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 4 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2250s21c1
Sequence:CCGGGAAGCTCTATGGTCTTATTATCTCGAGATAATAAGACCATAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2538s21c1
Sequence:CCGGCAGTCCTATCTAGACCTATAACTCGAGTTATAGGTCTAGATAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2136s21c1
Sequence:CCGGGGCTTCTTCTACACATATTAACTCGAGTTAATATGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010167.4-1446s21c1
Sequence:CCGGATGTTTCCTCCGACGACAATGCTCGAGCATTGTCGTCGGAGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010167.2-3132s1c1
Sequence:CCGGGCCATGTTCATATCAACATATCTCGAGATATGTTGATATGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1896s1c1
Sequence:CCGGGAGCGAATAATGCAAAGGTTTCTCGAGAAACCTTTGCATTATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1362s1c1
Sequence:CCGGCGGATGGAAGAAATGATCTTTCTCGAGAAAGATCATTTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1699s1c1
Sequence:CCGGGCCTAACAGATTCCTGGCTAACTCGAGTTAGCCAGGAATCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-609s1c1
Sequence:CCGGGCTCAAACAATGTCGGCCTATCTCGAGATAGGCCGACATTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010167
EYA4 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 4 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2250s21c1
Sequence:CCGGGAAGCTCTATGGTCTTATTATCTCGAGATAATAAGACCATAGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440950    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2538s21c1
Sequence:CCGGCAGTCCTATCTAGACCTATAACTCGAGTTATAGGTCTAGATAGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441814    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010167.4-2136s21c1
Sequence:CCGGGGCTTCTTCTACACATATTAACTCGAGTTAATATGTGTAGAAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454509    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010167.4-1446s21c1
Sequence:CCGGATGTTTCCTCCGACGACAATGCTCGAGCATTGTCGTCGGAGGAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097800    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010167.2-3132s1c1
Sequence:CCGGGCCATGTTCATATCAACATATCTCGAGATATGTTGATATGAACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1896s1c1
Sequence:CCGGGAGCGAATAATGCAAAGGTTTCTCGAGAAACCTTTGCATTATTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1362s1c1
Sequence:CCGGCGGATGGAAGAAATGATCTTTCTCGAGAAAGATCATTTCTTCCATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-1699s1c1
Sequence:CCGGGCCTAACAGATTCCTGGCTAACTCGAGTTAGCCAGGAATCTGTTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010167.2-609s1c1
Sequence:CCGGGCTCAAACAATGTCGGCCTATCTCGAGATAGGCCGACATTGTTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004100
VALIDATED
EYA4 MISSION shRNA Bacterial Glycerol Stock
eyes absent homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2022s21c1
Sequence:GTACCGGACAGATTCCTGGCTAACAAATCTCGAGATTTGTTAGCCAGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2125s21c1
Sequence:GTACCGGTTGCGAAGGTTCTACTCTATACTCGAGTATAGAGTAGAACCTTCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2827s21c1
Sequence:CCGGGTATAAGGACAGTCCTATTTACTCGAGTAAATAGGACTGTCCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-1193s21c1
Sequence:CCGGTGCACCATCATCTACTATTTACTCGAGTAAATAGTAGATGATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004100.4-1320s21c1
Sequence:CCGGTCAACGTATGGAGCGTATATGCTCGAGCATATACGCTCCATACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1604s1c1
Sequence:CCGGCGGGTCTTATGCACAGAAGTACTCGAGTACTTCTGTGCATAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004100.2-2191s1c1
Sequence:CCGGGCTTTGAACGAATAATGCAAACTCGAGTTTGCATTATTCGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1547s1c1
Sequence:CCGGGCGTGTGTTTGTCTGGGATTTCTCGAGAAATCCCAGACAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-616s1c1
Sequence:CCGGGCAGCACATCAGTTACTACAACTCGAGTTGTAGTAACTGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-2011s1c1
Sequence:CCGGCCTGGCTAACAAATGCACTTACTCGAGTAAGTGCATTTGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004100
VALIDATED
EYA4 MISSION shRNA shRNA Plasmid DNA
eyes absent homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2022s21c1
Sequence:GTACCGGACAGATTCCTGGCTAACAAATCTCGAGATTTGTTAGCCAGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2125s21c1
Sequence:GTACCGGTTGCGAAGGTTCTACTCTATACTCGAGTATAGAGTAGAACCTTCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2827s21c1
Sequence:CCGGGTATAAGGACAGTCCTATTTACTCGAGTAAATAGGACTGTCCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-1193s21c1
Sequence:CCGGTGCACCATCATCTACTATTTACTCGAGTAAATAGTAGATGATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004100.4-1320s21c1
Sequence:CCGGTCAACGTATGGAGCGTATATGCTCGAGCATATACGCTCCATACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1604s1c1
Sequence:CCGGCGGGTCTTATGCACAGAAGTACTCGAGTACTTCTGTGCATAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004100.2-2191s1c1
Sequence:CCGGGCTTTGAACGAATAATGCAAACTCGAGTTTGCATTATTCGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1547s1c1
Sequence:CCGGGCGTGTGTTTGTCTGGGATTTCTCGAGAAATCCCAGACAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-616s1c1
Sequence:CCGGGCAGCACATCAGTTACTACAACTCGAGTTGTAGTAACTGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-2011s1c1
Sequence:CCGGCCTGGCTAACAAATGCACTTACTCGAGTAAGTGCATTTGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004100
VALIDATED
EYA4 MISSION shRNA Lentiviral Transduction Particles
eyes absent homolog 4 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2022s21c1
Sequence:GTACCGGACAGATTCCTGGCTAACAAATCTCGAGATTTGTTAGCCAGGAATCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218273    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2125s21c1
Sequence:GTACCGGTTGCGAAGGTTCTACTCTATACTCGAGTATAGAGTAGAACCTTCGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244430    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-2827s21c1
Sequence:CCGGGTATAAGGACAGTCCTATTTACTCGAGTAAATAGGACTGTCCTTATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_004100.4-1193s21c1
Sequence:CCGGTGCACCATCATCTACTATTTACTCGAGTAAATAGTAGATGATGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004100.4-1320s21c1
Sequence:CCGGTCAACGTATGGAGCGTATATGCTCGAGCATATACGCTCCATACGTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1604s1c1
Sequence:CCGGCGGGTCTTATGCACAGAAGTACTCGAGTACTTCTGTGCATAAGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004100.2-2191s1c1
Sequence:CCGGGCTTTGAACGAATAATGCAAACTCGAGTTTGCATTATTCGTTCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-1547s1c1
Sequence:CCGGGCGTGTGTTTGTCTGGGATTTCTCGAGAAATCCCAGACAAACACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-616s1c1
Sequence:CCGGGCAGCACATCAGTTACTACAACTCGAGTTGTAGTAACTGATGTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051095    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004100.2-2011s1c1
Sequence:CCGGCCTGGCTAACAAATGCACTTACTCGAGTAAGTGCATTTGTTAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks