EMAIL THIS PAGE TO A FRIEND

EYS

eyes shut homolog (Drosophila)

44 Gene Product Result for
Synonyms: C6orf178 C6orf179 C6orf180 EGFL10 EGFL11 RP25 SPAM bA166P24.2 bA307F22.3 bA74E24.1 dJ1018A4.2 dJ22I17.2 dJ303F19.1
Gene ID:
Human(346007) Summary: The product of this gene contains multiple epidermal growth factor (EGF)-like and LamG domains. The protein is expressed in the photoreceptor layer of the retina, and the gene is mutated in autosomal recessive retinitis pigmentosa. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
fruit fly(3771890) eyes shut
dog(610772) eyes shut homolog (Drosophila)
Horse(100070526) eyes shut homolog (Drosophila)
chicken(428640) eyes shut homolog (Drosophila)
domestic guinea pig(101787331) eyes shut homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1402091 Monoclonal Anti-EYS antibody produced in mouse clone 3F2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198283 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198283 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198283 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042411 MISSION® esiRNA esiRNA human EGFL11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198283 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198283 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092197 predicted 1446
2 SASI_Hs01_00092198 predicted 797
3 SASI_Hs01_00092199 predicted 818
4 SASI_Hs02_00371845 predicted 1605
5 SASI_Hs02_00371846 predicted 1561
6 SASI_Hs01_00092201 predicted 1323
7 SASI_Hs01_00092202 predicted 1375
8 SASI_Hs01_00092203 predicted 1924
9 SASI_Hs01_00092205 predicted 1911
10 SASI_Hs02_00371847 predicted 2001
11 SASI_Hs01_00092200 predicted 1888
12 SASI_Hs01_00092204 predicted 1503
13 SASI_Hs01_00092206 predicted 653
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198283
EYS MISSION shRNA Bacterial Glycerol Stock
eyes shut homolog (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1029s1c1
Sequence:CCGGGCCAGGAACTTGATGCATGTTCTCGAGAACATGCATCAAGTTCCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1132s1c1
Sequence:CCGGCCCACCATTTACAGGAAAGAACTCGAGTTCTTTCCTGTAAATGGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1578s1c1
Sequence:CCGGGCAGCTGTATATCAGGATTTACTCGAGTAAATCCTGATATACAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-493s1c1
Sequence:CCGGGCATCCACAACCCTCATCATACTCGAGTATGATGAGGGTTGTGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-2037s1c1
Sequence:CCGGGTCAGGAATATCGGTATCTATCTCGAGATAGATACCGATATTCCTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1740s21c1
Sequence:CCGGTGAAGAATGTTTACCTAATTCCTCGAGGAATTAGGTAAACATTCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1809s21c1
Sequence:CCGGATAAAGGTCCTGCTCAATTTGCTCGAGCAAATTGAGCAGGACCTTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-2150s21c1
Sequence:CCGGATTAATAGACCCAGGTATTTACTCGAGTAAATACCTGGGTCTATTAATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1939s21c1
Sequence:CCGGGAACGATCCTGAAGATAATAACTCGAGTTATTATCTTCAGGATCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198283
EYS MISSION shRNA shRNA Plasmid DNA
eyes shut homolog (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1029s1c1
Sequence:CCGGGCCAGGAACTTGATGCATGTTCTCGAGAACATGCATCAAGTTCCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1132s1c1
Sequence:CCGGCCCACCATTTACAGGAAAGAACTCGAGTTCTTTCCTGTAAATGGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1578s1c1
Sequence:CCGGGCAGCTGTATATCAGGATTTACTCGAGTAAATCCTGATATACAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-493s1c1
Sequence:CCGGGCATCCACAACCCTCATCATACTCGAGTATGATGAGGGTTGTGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-2037s1c1
Sequence:CCGGGTCAGGAATATCGGTATCTATCTCGAGATAGATACCGATATTCCTGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1740s21c1
Sequence:CCGGTGAAGAATGTTTACCTAATTCCTCGAGGAATTAGGTAAACATTCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1809s21c1
Sequence:CCGGATAAAGGTCCTGCTCAATTTGCTCGAGCAAATTGAGCAGGACCTTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-2150s21c1
Sequence:CCGGATTAATAGACCCAGGTATTTACTCGAGTAAATACCTGGGTCTATTAATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1939s21c1
Sequence:CCGGGAACGATCCTGAAGATAATAACTCGAGTTATTATCTTCAGGATCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198283
EYS MISSION shRNA Lentiviral Transduction Particles
eyes shut homolog (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1029s1c1
Sequence:CCGGGCCAGGAACTTGATGCATGTTCTCGAGAACATGCATCAAGTTCCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1132s1c1
Sequence:CCGGCCCACCATTTACAGGAAAGAACTCGAGTTCTTTCCTGTAAATGGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-1578s1c1
Sequence:CCGGGCAGCTGTATATCAGGATTTACTCGAGTAAATCCTGATATACAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-493s1c1
Sequence:CCGGGCATCCACAACCCTCATCATACTCGAGTATGATGAGGGTTGTGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198283.1-2037s1c1
Sequence:CCGGGTCAGGAATATCGGTATCTATCTCGAGATAGATACCGATATTCCTGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427855    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1740s21c1
Sequence:CCGGTGAAGAATGTTTACCTAATTCCTCGAGGAATTAGGTAAACATTCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1809s21c1
Sequence:CCGGATAAAGGTCCTGCTCAATTTGCTCGAGCAAATTGAGCAGGACCTTTATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-2150s21c1
Sequence:CCGGATTAATAGACCCAGGTATTTACTCGAGTAAATACCTGGGTCTATTAATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198283.1-1939s21c1
Sequence:CCGGGAACGATCCTGAAGATAATAACTCGAGTTATTATCTTCAGGATCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)