EMAIL THIS PAGE TO A FRIEND

EZH1

enhancer of zeste homolog 1 (Drosophila)

52 Gene Product Result for
Synonyms: KMT6B
Gene ID:
Human(2145) Summary: EZH1 is a component of a noncanonical Polycomb repressive complex-2 (PRC2) that mediates methylation of histone H3 (see MIM 602812) lys27 (H3K27) and functions in the maintenance of embryonic stem cell pluripotency and plasticity (Shen et al., 2008 [PubMed 19026780]
Mouse(14055) enhancer of zeste homolog 1 (Drosophila)
Rat(303547) enhancer of zeste homolog 1 (Drosophila)
sheep(101104765) enhancer of zeste homolog 1 (Drosophila)
Domestic Rabbit(100351852) enhancer of zeste homolog 1 (Drosophila)
domestic guinea pig(100720693) enhancer of zeste homolog 1 (Drosophila)
naked mole-rat(101723063) enhancer of zeste homolog 1 (Drosophila)
Zebrafish(664754) enhancer of zeste homolog 1 (Drosophila)
domestic cat(101099602) enhancer of zeste homolog 1 (Drosophila)
cow(533087) enhancer of zeste homolog 1 (Drosophila)
Horse(100052411) enhancer of zeste homolog 1 (Drosophila)
dog(480516) enhancer of zeste homolog 1 (Drosophila)
chicken(420023) enhancer of zeste homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001991 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001991 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001991 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007970 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007970 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007970 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001991 Rosetta Predictions human pricing
NM_001107051 Rosetta Predictions rat pricing
NM_007970 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332978 predicted 569
2 SASI_Hs02_00332979 predicted 840
3 SASI_Hs01_00038089 predicted 795
4 SASI_Hs01_00038090 predicted 732
5 SASI_Hs01_00038091 predicted 883
6 SASI_Hs01_00038092 predicted 1646
7 SASI_Hs01_00038093 predicted 2257
8 SASI_Hs01_00038094 predicted 2382
9 SASI_Hs01_00038096 predicted 605
10 SASI_Hs01_00038097 predicted 1842
11 SASI_Hs01_00038095 predicted 1554
12 SASI_Hs01_00038098 predicted 1297
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107051 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225006 predicted 1857
2 SASI_Rn02_00225007 predicted 1750
3 SASI_Rn02_00225008 predicted 1466
4 SASI_Rn02_00225009 predicted 1678
5 SASI_Rn02_00225010 predicted 1604
6 SASI_Rn02_00225011 predicted 1971
7 SASI_Rn02_00225012 predicted 765
8 SASI_Rn02_00225013 predicted 349
9 SASI_Rn02_00225014 predicted 744
10 SASI_Rn02_00225015 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007970 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190609 predicted 571
2 SASI_Mm01_00190610 predicted 1572
3 SASI_Mm01_00190611 predicted 1904
4 SASI_Mm01_00190612 predicted 2229
5 SASI_Mm01_00190613 predicted 799
6 SASI_Mm01_00190614 predicted 1727
7 SASI_Mm01_00190615 predicted 1508
8 SASI_Mm01_00190616 predicted 1805
9 SASI_Mm01_00190617 predicted 1782
10 SASI_Mm01_00190618 predicted 1650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001991
EZH1 MISSION shRNA Bacterial Glycerol Stock
enhancer of zeste homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001991.3-2667s21c1
Sequence:CCGGTGGATGACTTATGCGTGATTTCTCGAGAAATCACGCATAAGTCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1533s21c1
Sequence:CCGGAGACGTGCAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTGCACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1867s21c1
Sequence:CCGGCTATCTGGCAGTGCGAGAATGCTCGAGCATTCTCGCACTGCCAGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2116s1c1
Sequence:CCGGGCTTCCTCTTCAACCTCAATACTCGAGTATTGAGGTTGAAGAGGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-474s1c1
Sequence:CCGGCAACAGAACTTTATGGTAGAACTCGAGTTCTACCATAAAGTTCTGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001991.x-4159s1c1
Sequence:CCGGCCGCCGTGGTTTGTATTCATTCTCGAGAATGAATACAAACCACGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2288s1c1
Sequence:CCGGGCTCTTCTTTGATTACAGGTACTCGAGTACCTGTAATCAAAGAAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2154s1c1
Sequence:CCGGGCTACTCGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCGAGTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001991
EZH1 MISSION shRNA shRNA Plasmid DNA
enhancer of zeste homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001991.3-2667s21c1
Sequence:CCGGTGGATGACTTATGCGTGATTTCTCGAGAAATCACGCATAAGTCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1533s21c1
Sequence:CCGGAGACGTGCAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTGCACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1867s21c1
Sequence:CCGGCTATCTGGCAGTGCGAGAATGCTCGAGCATTCTCGCACTGCCAGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2116s1c1
Sequence:CCGGGCTTCCTCTTCAACCTCAATACTCGAGTATTGAGGTTGAAGAGGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-474s1c1
Sequence:CCGGCAACAGAACTTTATGGTAGAACTCGAGTTCTACCATAAAGTTCTGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001991.x-4159s1c1
Sequence:CCGGCCGCCGTGGTTTGTATTCATTCTCGAGAATGAATACAAACCACGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2288s1c1
Sequence:CCGGGCTCTTCTTTGATTACAGGTACTCGAGTACCTGTAATCAAAGAAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2154s1c1
Sequence:CCGGGCTACTCGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCGAGTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001991
EZH1 MISSION shRNA Lentiviral Transduction Particles
enhancer of zeste homolog 1 (Drosophila)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378151    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001991.3-2667s21c1
Sequence:CCGGTGGATGACTTATGCGTGATTTCTCGAGAAATCACGCATAAGTCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1533s21c1
Sequence:CCGGAGACGTGCAAGCAGGTCTTTCCTCGAGGAAAGACCTGCTTGCACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001991.3-1867s21c1
Sequence:CCGGCTATCTGGCAGTGCGAGAATGCTCGAGCATTCTCGCACTGCCAGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2116s1c1
Sequence:CCGGGCTTCCTCTTCAACCTCAATACTCGAGTATTGAGGTTGAAGAGGAAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-474s1c1
Sequence:CCGGCAACAGAACTTTATGGTAGAACTCGAGTTCTACCATAAAGTTCTGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002441    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001991.x-4159s1c1
Sequence:CCGGCCGCCGTGGTTTGTATTCATTCTCGAGAATGAATACAAACCACGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2288s1c1
Sequence:CCGGGCTCTTCTTTGATTACAGGTACTCGAGTACCTGTAATCAAAGAAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001991.x-2154s1c1
Sequence:CCGGGCTACTCGGAAAGGAAACAAACTCGAGTTTGTTTCCTTTCCGAGTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007970
VALIDATED
EZH1 MISSION shRNA Bacterial Glycerol Stock
enhancer of zeste homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2243s21c1
Sequence:CCGGATCACCGCATTGGGATCTTTGCTCGAGCAAAGATCCCAATGCGGTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-564s21c1
Sequence:CCGGCATCGAAGAGCTGATCAATAACTCGAGTTATTGATCAGCTCTTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2084s21c1
Sequence:CCGGATCGTCGAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTCGACGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007970.2-2614s21c1
Sequence:CCGGGATGGTGGGTGTGGGATAATGCTCGAGCATTATCCCACACCCACCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007970.2-1811s21c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007970.1-3797s1c1
Sequence:CCGGGCCTAACGATAGGCTCTGAATCTCGAGATTCAGAGCCTATCGTTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-2083s1c1
Sequence:CCGGCGAGGGAAGGTCTATGATAAACTCGAGTTTATCATAGACCTTCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-1805s1c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-436s1c1
Sequence:CCGGGCACTGGTTCCCATCATGTATCTCGAGATACATGATGGGAACCAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-1458s1c1
Sequence:CCGGCGGCACCTATTTCAACAACTTCTCGAGAAGTTGTTGAAATAGGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007970
VALIDATED
EZH1 MISSION shRNA shRNA Plasmid DNA
enhancer of zeste homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2243s21c1
Sequence:CCGGATCACCGCATTGGGATCTTTGCTCGAGCAAAGATCCCAATGCGGTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-564s21c1
Sequence:CCGGCATCGAAGAGCTGATCAATAACTCGAGTTATTGATCAGCTCTTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2084s21c1
Sequence:CCGGATCGTCGAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTCGACGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007970.2-2614s21c1
Sequence:CCGGGATGGTGGGTGTGGGATAATGCTCGAGCATTATCCCACACCCACCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007970.2-1811s21c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007970.1-3797s1c1
Sequence:CCGGGCCTAACGATAGGCTCTGAATCTCGAGATTCAGAGCCTATCGTTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-2083s1c1
Sequence:CCGGCGAGGGAAGGTCTATGATAAACTCGAGTTTATCATAGACCTTCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-1805s1c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-436s1c1
Sequence:CCGGGCACTGGTTCCCATCATGTATCTCGAGATACATGATGGGAACCAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000095695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-1458s1c1
Sequence:CCGGCGGCACCTATTTCAACAACTTCTCGAGAAGTTGTTGAAATAGGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007970
VALIDATED
EZH1 MISSION shRNA Lentiviral Transduction Particles
enhancer of zeste homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313532    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2243s21c1
Sequence:CCGGATCACCGCATTGGGATCTTTGCTCGAGCAAAGATCCCAATGCGGTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-564s21c1
Sequence:CCGGCATCGAAGAGCTGATCAATAACTCGAGTTATTGATCAGCTCTTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007970.2-2084s21c1
Sequence:CCGGATCGTCGAGGGAAGGTCTATGCTCGAGCATAGACCTTCCCTCGACGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349892    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007970.2-2614s21c1
Sequence:CCGGGATGGTGGGTGTGGGATAATGCTCGAGCATTATCCCACACCCACCATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007970.2-1811s21c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007970.1-3797s1c1
Sequence:CCGGGCCTAACGATAGGCTCTGAATCTCGAGATTCAGAGCCTATCGTTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-2083s1c1
Sequence:CCGGCGAGGGAAGGTCTATGATAAACTCGAGTTTATCATAGACCTTCCCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095697    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007970.1-1805s1c1
Sequence:CCGGGCTGTAAGACTCAGTGCAATACTCGAGTATTGCACTGAGTCTTACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095698    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-436s1c1
Sequence:CCGGGCACTGGTTCCCATCATGTATCTCGAGATACATGATGGGAACCAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000095695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007970.1-1458s1c1
Sequence:CCGGCGGCACCTATTTCAACAACTTCTCGAGAAGTTGTTGAAATAGGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)