EMAIL THIS PAGE TO A FRIEND

EZH2

enhancer of zeste homolog 2 (Drosophila)

147 Gene Product Result for
Synonyms: ENX-1 ENX1 EZH1 EZH2b KMT6 KMT6A WVS WVS2
Gene ID:
Human(2146) Summary: This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
Mouse(14056) enhancer of zeste homolog 2 (Drosophila)
Rat(312299) enhancer of zeste homolog 2 (Drosophila)
Zebrafish(768133) enhancer of zeste homolog 2 (Drosophila)
chicken(420784) enhancer of zeste homolog 2 (Drosophila)
domestic cat(101087309) enhancer of zeste homolog 2 (Drosophila)
cow(509106) enhancer of zeste homolog 2 (Drosophila)
Horse(100051290) enhancer of zeste homolog 2 (Drosophila)
dog(475511) enhancer of zeste homolog 2 (Drosophila)
naked mole-rat(101702710) enhancer of zeste homolog 2 (Drosophila)
domestic guinea pig(100713765) enhancer of zeste homolog 2 (Drosophila)
sheep(101120745) enhancer of zeste homolog 2 (Drosophila)
Domestic Rabbit(100345157) enhancer of zeste homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E7031 Anti-EZH2 (N-terminal) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1405776 Anti-EZH2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
E6906 Anti-EZH2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunofluorescence, western blot pricing
AV38470 Anti-EZH2 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder canine, bovine, human, rat, mouse, chicken, zebrafish
immunohistochemistry, western blot pricing
HPA029131 Anti-EZH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106436 Anti-EZH2 antibody produced in rabbit affinity isolated antibody horse, human, rabbit, bovine, canine, mouse, guinea pig, zebrafish, rat, African clawed frog
ELISA, western blot pricing
SAB1410354 Anti-EZH2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB5500102 Anti-EZH2 antibody, Rabbit monoclonal clone SP129, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB1408985 Monoclonal Anti-EZH2 antibody produced in mouse clone 1D11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

Proteins

Product # Description Species Add to Cart
 
SRP0132 EZH2 / EED / SUZ12 human recombinant, expressed in baculovirus infected insect cells, ≥90% (SDS-PAGE) human pricing
SRP0380 EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE) human pricing
SRP0381 EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE) human pricing
SRP0382 EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥75% (SDS-PAGE) human pricing
SRP0387 EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥56% (SDS-PAGE) human pricing
SRP0388 EZH2 /EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE) human pricing
SRP0379 EZH2 human recombinant, expressed in baculovirus infected Sf9 cells, ≥49% (SDS-PAGE) human pricing
SRP0133 EZH2/EED inactive  human recombinant, expressed in baculovirus infected insect cells, ≥70% (SDS-PAGE) human pricing
SRP0394 EZH2/EED/SUZ12/RbAp48 active human recombinant, expressed in baculovirus infected Sf9 cells, ≥90% (SDS-PAGE) human pricing
SRP0134 EZH2/EED/SUZ12/RbAp48/AEBP2 human recombinant, expressed in baculovirus infected insect cells human pricing
SRP0393 EZH2/SUZ12/RbAp48 human recombinant, expressed in baculovirus infected Sf9 cells, ≥88% (SDS-PAGE) human pricing
APREST87002 PrEST Antigen EZH2 Prestige Antigens Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST27215 SILuPrEST EZH2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing
QPREST27216 SILuPrEST EZH2 SILuPrESTs Powered by Atlas Antibodies, buffered aqueous solution human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004456 Rosetta Predictions human pricing
NM_152998 Rosetta Predictions human pricing
NM_001134979 Rosetta Predictions rat pricing
NM_007971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147882 predicted 2390
2 SASI_Hs02_00337644 predicted 1779
3 SASI_Hs01_00147883 predicted 1713
4 SASI_Hs01_00147884 predicted 2127
5 SASI_Hs01_00147885 predicted 1633
6 SASI_Hs01_00147886 predicted 2457
7 SASI_Hs01_00147887 predicted 2241
8 SASI_Hs01_00147888 predicted 1891
9 SASI_Hs01_00147889 predicted 1974
10 SASI_Hs01_00147890 predicted 2092
11 SASI_Hs01_00147891 predicted 2295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022212 predicted 2261
2 SASI_Hs02_00366956 predicted 1646
3 SASI_Hs01_00022213 predicted 1581
4 SASI_Hs01_00022214 predicted 1999
5 SASI_Hs01_00022215 predicted 1496
6 SASI_Hs01_00022216 predicted 2326
7 SASI_Hs01_00022217 predicted 2115
8 SASI_Hs01_00022218 predicted 1759
9 SASI_Hs01_00022219 predicted 1845
10 SASI_Hs01_00022220 predicted 1966
11 SASI_Hs01_00022221 predicted 2164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00259194 predicted 1466
2 SASI_Rn02_00259195 predicted 1678
3 SASI_Rn02_00259196 predicted 2300
4 SASI_Rn02_00259197 predicted 1152
5 SASI_Rn02_00259198 predicted 1545
6 SASI_Rn02_00259199 predicted 465
7 SASI_Rn02_00259200 predicted 2368
8 SASI_Rn02_00259201 predicted 2360
9 SASI_Rn02_00259202 predicted 1538
10 SASI_Rn02_00259203 predicted 2066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00061985 predicted 947
2 SASI_Mm01_00061986 predicted 1135
3 SASI_Mm01_00061987 predicted 1462
4 SASI_Mm01_00061988 predicted 1672
5 SASI_Mm01_00061989 predicted 2256
6 SASI_Mm02_00312863 predicted 1633
7 SASI_Mm01_00061990 predicted 1542
8 SASI_Mm01_00061992 predicted 1510
9 SASI_Mm01_00061993 predicted 2064
10 SASI_Mm02_00312864 predicted 407
11 SASI_Mm01_00061991 predicted 1279
12 SASI_Mm01_00061994 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004456
VALIDATED
EZH2 MISSION shRNA Bacterial Glycerol Stock
enhancer of zeste homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-1544s1c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-950s1c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-440s1c1
Sequence:CCGGCCAACACAAGTCATCCCATTACTCGAGTAATGGGATGACTTGTGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-2278s21c1
Sequence:CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-324s21c1
Sequence:CCGGCGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAAGATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2582s21c1
Sequence:CCGGTATTGCCTTCTCACCAGCTGCCTCGAGGCAGCTGGTGAGAAGGCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-1544s21c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-950s21c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2450s21c1
Sequence:CCGGGAAACAGCTGCCTTAGCTTCACTCGAGTGAAGCTAAGGCAGCTGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004456
VALIDATED
EZH2 MISSION shRNA shRNA Plasmid DNA
enhancer of zeste homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-1544s1c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-950s1c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000040075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-440s1c1
Sequence:CCGGCCAACACAAGTCATCCCATTACTCGAGTAATGGGATGACTTGTGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-2278s21c1
Sequence:CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-324s21c1
Sequence:CCGGCGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAAGATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2582s21c1
Sequence:CCGGTATTGCCTTCTCACCAGCTGCCTCGAGGCAGCTGGTGAGAAGGCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-1544s21c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-950s21c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2450s21c1
Sequence:CCGGGAAACAGCTGCCTTAGCTTCACTCGAGTGAAGCTAAGGCAGCTGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004456
VALIDATED
EZH2 MISSION shRNA Lentiviral Transduction Particles
enhancer of zeste homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-1544s1c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-950s1c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000040075    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004456.3-440s1c1
Sequence:CCGGCCAACACAAGTCATCCCATTACTCGAGTAATGGGATGACTTGTGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-2278s21c1
Sequence:CCGGTATGATGGTTAACGGTGATCACTCGAGTGATCACCGTTAACCATCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-324s21c1
Sequence:CCGGCGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAAGATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286227    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2582s21c1
Sequence:CCGGTATTGCCTTCTCACCAGCTGCCTCGAGGCAGCTGGTGAGAAGGCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-1544s21c1
Sequence:CCGGGCTAGGTTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAACCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004456.3-950s21c1
Sequence:CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293738    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004456.3-2450s21c1
Sequence:CCGGGAAACAGCTGCCTTAGCTTCACTCGAGTGAAGCTAAGGCAGCTGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007971
VALIDATED
EZH2 MISSION shRNA Bacterial Glycerol Stock
enhancer of zeste homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1905s1c1
Sequence:CCGGGCTGACCATTGGGACAGTAAACTCGAGTTTACTGTCCCAATGGTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-841s1c1
Sequence:CCGGCCGCAGAAGAACTGAAAGAAACTCGAGTTTCTTTCAGTTCTTCTGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1157s1c1
Sequence:CCGGGCGTATAAAGACACCACCTAACTCGAGTTAGGTGGTGTCTTTATACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-1497s1c1
Sequence:CCGGGCTAGGCTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAGCCTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-778s21c1
Sequence:CCGGACTTGCCCACCTCGGAAATTTCTCGAGAAATTTCCGAGGTGGGCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-2440s21c1
Sequence:CCGGTTGAGTACTGTGGGCAATTTACTCGAGTAAATTGCCCACAGTACTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007971.2-453s21c1
Sequence:CCGGAGTCGCCTCGGTGCCTATAATCTCGAGATTATAGGCACCGAGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-1677s21c1
Sequence:CCGGCGGCTCCTCTAACCATGTTTACTCGAGTAAACATGGTTAGAGGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-421s21c1
Sequence:CCGGGCACAAGTCATCCCGTTAAAGCTCGAGCTTTAACGGGATGACTTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007971
VALIDATED
EZH2 MISSION shRNA shRNA Plasmid DNA
enhancer of zeste homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1905s1c1
Sequence:CCGGGCTGACCATTGGGACAGTAAACTCGAGTTTACTGTCCCAATGGTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-841s1c1
Sequence:CCGGCCGCAGAAGAACTGAAAGAAACTCGAGTTTCTTTCAGTTCTTCTGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1157s1c1
Sequence:CCGGGCGTATAAAGACACCACCTAACTCGAGTTAGGTGGTGTCTTTATACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-1497s1c1
Sequence:CCGGGCTAGGCTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAGCCTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-778s21c1
Sequence:CCGGACTTGCCCACCTCGGAAATTTCTCGAGAAATTTCCGAGGTGGGCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-2440s21c1
Sequence:CCGGTTGAGTACTGTGGGCAATTTACTCGAGTAAATTGCCCACAGTACTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007971.2-453s21c1
Sequence:CCGGAGTCGCCTCGGTGCCTATAATCTCGAGATTATAGGCACCGAGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000301834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-1677s21c1
Sequence:CCGGCGGCTCCTCTAACCATGTTTACTCGAGTAAACATGGTTAGAGGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000304506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-421s21c1
Sequence:CCGGGCACAAGTCATCCCGTTAAAGCTCGAGCTTTAACGGGATGACTTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007971
VALIDATED
EZH2 MISSION shRNA Lentiviral Transduction Particles
enhancer of zeste homolog 2 (Drosophila)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1905s1c1
Sequence:CCGGGCTGACCATTGGGACAGTAAACTCGAGTTTACTGTCCCAATGGTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-841s1c1
Sequence:CCGGCCGCAGAAGAACTGAAAGAAACTCGAGTTTCTTTCAGTTCTTCTGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039039    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007971.1-1157s1c1
Sequence:CCGGGCGTATAAAGACACCACCTAACTCGAGTTAGGTGGTGTCTTTATACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007971.1-1497s1c1
Sequence:CCGGGCTAGGCTAATTGGGACCAAACTCGAGTTTGGTCCCAATTAGCCTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-778s21c1
Sequence:CCGGACTTGCCCACCTCGGAAATTTCTCGAGAAATTTCCGAGGTGGGCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-2440s21c1
Sequence:CCGGTTGAGTACTGTGGGCAATTTACTCGAGTAAATTGCCCACAGTACTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007971.2-453s21c1
Sequence:CCGGAGTCGCCTCGGTGCCTATAATCTCGAGATTATAGGCACCGAGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000301834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-1677s21c1
Sequence:CCGGCGGCTCCTCTAACCATGTTTACTCGAGTAAACATGGTTAGAGGAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000304506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007971.2-421s21c1
Sequence:CCGGGCACAAGTCATCCCGTTAAAGCTCGAGCTTTAACGGGATGACTTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)