EMAIL THIS PAGE TO A FRIEND

EZR

ezrin

117 Gene Product Result for
Synonyms: CVIL CVL VIL2
UniProtKB ID: P15311, E1P5A8, P23714, Q4VX75, Q96CU8, Q9NSJ4
Gene ID:
Human(7430) Summary: The cytoplasmic peripheral membrane protein encoded by this gene functions as a protein-tyrosine kinase substrate in microvilli. As a member of the ERM protein family, this protein serves as an intermediate between the plasma membrane and the actin cytoskeleton. This protein plays a key role in cell surface structure adhesion, migration and organization, and it has been implicated in various human cancers. A pseudogene located on chromosome 3 has been identified for this gene. Alternatively spliced variants have also been described for this gene. [provided by RefSeq, Jul 2008]
Mouse(22350) ezrin
Rat(54319) ezrin
cow(281574) ezrin
dog(484056) ezrin
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300372 Anti-EZR (Ab-353) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300460 Anti-EZR (Ab-567) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB1406584 Anti-EZR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human, rat
western blot pricing
HPA021616 Anti-EZR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
E1281 Anti-Ezrin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human
immunofluorescence, immunohistochemistry, immunoprecipitation, western blot pricing
SAB4503077 Anti-Ezrin antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4503078 Anti-Ezrin antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503076 Anti-Ezrin, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4503079 Anti-Ezrin, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4503080 Anti-Ezrin, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB2500374 Anti-EZRIN/VILLIN 2 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4300162 Anti-phospho-EZR (pThr567) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB4300049 Anti-phospho-EZR (pTyr353) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504401 Anti-phospho-Ezrin (pThr566) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4504581 Anti-phospho-Ezrin (pTyr146) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301409 Anti-phospho-Ezrin (pTyr146) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504402 Anti-phospho-Ezrin (pTyr353) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4504582 Anti-phospho-Ezrin (pTyr478) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
SAB4301408 Anti-phospho-Ezrin (pTyr478) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1402391 Monoclonal Anti-EZR antibody produced in mouse clone 1E11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
E8897 Monoclonal Anti-Ezrin antibody produced in mouse clone 3C12, ascites fluid bovine, human, monkey, kangaroo rat, hamster, mouse
immunocytochemistry, immunohistochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009510 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009510 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009510 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003379 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003379 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003379 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111077 Rosetta Predictions human pricing
NM_003379 Rosetta Predictions human pricing
NM_019357 Rosetta Predictions rat pricing
NM_009510 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111077 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00325226 predicted 912
2 SASI_Hs02_00325227 predicted 2194
3 SASI_Hs02_00325228 predicted 776
4 SASI_Hs02_00325229 predicted 506
5 SASI_Hs02_00325230 predicted 408
6 SASI_Hs02_00325231 predicted 2217
7 SASI_Hs02_00325232 predicted 638
8 SASI_Hs02_00325233 predicted 2073
9 SASI_Hs02_00325234 predicted 641
10 SASI_Hs02_00325235 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003379 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335540 predicted 953
2 SASI_Hs01_00229948 predicted 2232
3 SASI_Hs01_00229949 predicted 813
4 SASI_Hs01_00229951 predicted 531
5 SASI_Hs01_00229952 predicted 441
6 SASI_Hs01_00229953 predicted 2254
7 SASI_Hs01_00229954 predicted 681
8 SASI_Hs01_00229955 predicted 2106
9 SASI_Hs01_00229957 predicted 670
10 SASI_Hs02_00335541 predicted 367
11 SASI_Hs01_00229950 predicted 795
12 SASI_Hs01_00229956 predicted 242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019357 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043027 predicted 1145
2 SASI_Rn01_00043029 predicted 871
3 SASI_Rn01_00043030 predicted 1074
4 SASI_Rn01_00043031 predicted 1434
5 SASI_Rn01_00043032 predicted 600
6 SASI_Rn01_00043034 predicted 1300
7 SASI_Rn02_00262367 predicted 1081
8 SASI_Rn02_00262368 predicted 1147
9 SASI_Rn02_00262369 predicted 559
10 SASI_Rn01_00043036 predicted 528
11 SASI_Rn01_00043028 predicted 1093
12 SASI_Rn01_00043033 predicted 1253
13 SASI_Rn01_00043035 predicted 2230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009510 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183011 predicted 357
2 SASI_Mm02_00316297 predicted 805
3 SASI_Mm01_00183013 predicted 730
4 SASI_Mm01_00183014 predicted 1943
5 SASI_Mm01_00183015 predicted 261
6 SASI_Mm02_00316298 predicted 693
7 SASI_Mm02_00316299 predicted 732
8 SASI_Mm02_00316300 predicted 801
9 SASI_Mm02_00316301 predicted 912
10 SASI_Mm01_00183017 predicted 1822
11 SASI_Mm01_00183012 predicted 535
12 SASI_Mm01_00183016 predicted 223
13 SASI_Mm01_00183018 predicted 896
14 SASI_Mm01_00183019 predicted 1007
15 SASI_Mm01_00183020 predicted 1793
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009510
VALIDATED
EZR MISSION shRNA Bacterial Glycerol Stock
ezrin
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-1990s21c1
Sequence:GTACCGGGCTGTGTTCCAGTCCCTTAAACTCGAGTTTAAGGGACTGGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-956s21c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-801s21c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-539s21c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-2231s21c1
Sequence:CCGGACAATGAGCTCAAATCGATTTCTCGAGAAATCGATTTGAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-2087s21c1
Sequence:GTACCGGTGCCAAACAGGTCAGATTTAACTCGAGTTAAATCTGACCTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009510.2-1814s21c1
Sequence:GTACCGGGCAAGGCAGGGACAAGTATAACTCGAGTTATACTTGTCCCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-914s1c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-1521s1c1
Sequence:CCGGCCAGTGTATGAGCCTGTGAATCTCGAGATTCACAGGCTCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009510.1-232s1c1
Sequence:CCGGGCCTGCCGTATGTAGACAATACTCGAGTATTGTCTACATACGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-759s1c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-497s1c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009510
VALIDATED
EZR MISSION shRNA shRNA Plasmid DNA
ezrin
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-1990s21c1
Sequence:GTACCGGGCTGTGTTCCAGTCCCTTAAACTCGAGTTTAAGGGACTGGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-956s21c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-801s21c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-539s21c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-2231s21c1
Sequence:CCGGACAATGAGCTCAAATCGATTTCTCGAGAAATCGATTTGAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-2087s21c1
Sequence:GTACCGGTGCCAAACAGGTCAGATTTAACTCGAGTTAAATCTGACCTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009510.2-1814s21c1
Sequence:GTACCGGGCAAGGCAGGGACAAGTATAACTCGAGTTATACTTGTCCCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-914s1c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-1521s1c1
Sequence:CCGGCCAGTGTATGAGCCTGTGAATCTCGAGATTCACAGGCTCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009510.1-232s1c1
Sequence:CCGGGCCTGCCGTATGTAGACAATACTCGAGTATTGTCTACATACGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-759s1c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-497s1c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009510
VALIDATED
EZR MISSION shRNA Lentiviral Transduction Particles
ezrin
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382031    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-1990s21c1
Sequence:GTACCGGGCTGTGTTCCAGTCCCTTAAACTCGAGTTTAAGGGACTGGAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-956s21c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-801s21c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-539s21c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348506    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009510.2-2231s21c1
Sequence:CCGGACAATGAGCTCAAATCGATTTCTCGAGAAATCGATTTGAGCTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379840    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009510.2-2087s21c1
Sequence:GTACCGGTGCCAAACAGGTCAGATTTAACTCGAGTTAAATCTGACCTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009510.2-1814s21c1
Sequence:GTACCGGGCAAGGCAGGGACAAGTATAACTCGAGTTATACTTGTCCCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-914s1c1
Sequence:CCGGCCTGAGAATTAACAAGCGGATCTCGAGATCCGCTTGTTAATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-1521s1c1
Sequence:CCGGCCAGTGTATGAGCCTGTGAATCTCGAGATTCACAGGCTCATACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009510.1-232s1c1
Sequence:CCGGGCCTGCCGTATGTAGACAATACTCGAGTATTGTCTACATACGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-759s1c1
Sequence:CCGGGCCCTTGGACTTAACATTTATCTCGAGATAAATGTTAAGTCCAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009510.1-497s1c1
Sequence:CCGGCGGAGATTATAACAAGGAAATCTCGAGATTTCCTTGTTATAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003379
EZR MISSION shRNA Bacterial Glycerol Stock
ezrin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003379.4-2179s21c1
Sequence:GTACCGGGGCCTGATTCTCGCGATTATTCTCGAGAATAATCGCGAGAATCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-1070s21c1
Sequence:GTACCGGGGGCAACCATGAGTTGTATATCTCGAGATATACAACTCATGGTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-875s21c1
Sequence:GTACCGGTGATGCCCTTGGACTGAATATCTCGAGATATTCAGTCCAAGGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-752s21c1
Sequence:GTACCGGCCGTGGGATGCTCAAAGATAACTCGAGTTATCTTTGAGCATCCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-194s1c1
Sequence:CCGGCCAGCCAAATACAACTGGAAACTCGAGTTTCCAGTTGTATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-725s1c1
Sequence:CCGGCCTGGAAATGTATGGAATCAACTCGAGTTGATTCCATACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-672s1c1
Sequence:CCGGCGTGGGATGCTCAAAGATAATCTCGAGATTATCTTTGAGCATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-273s1c1
Sequence:CCGGCTCCACTATGTGGATAATAAACTCGAGTTTATTATCCACATAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-947s1c1
Sequence:CCGGCCCACGTCTGAGAATCAACAACTCGAGTTGTTGATTCTCAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003379
EZR MISSION shRNA shRNA Plasmid DNA
ezrin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003379.4-2179s21c1
Sequence:GTACCGGGGCCTGATTCTCGCGATTATTCTCGAGAATAATCGCGAGAATCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-1070s21c1
Sequence:GTACCGGGGGCAACCATGAGTTGTATATCTCGAGATATACAACTCATGGTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-875s21c1
Sequence:GTACCGGTGATGCCCTTGGACTGAATATCTCGAGATATTCAGTCCAAGGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-752s21c1
Sequence:GTACCGGCCGTGGGATGCTCAAAGATAACTCGAGTTATCTTTGAGCATCCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-194s1c1
Sequence:CCGGCCAGCCAAATACAACTGGAAACTCGAGTTTCCAGTTGTATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-725s1c1
Sequence:CCGGCCTGGAAATGTATGGAATCAACTCGAGTTGATTCCATACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-672s1c1
Sequence:CCGGCGTGGGATGCTCAAAGATAATCTCGAGATTATCTTTGAGCATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-273s1c1
Sequence:CCGGCTCCACTATGTGGATAATAAACTCGAGTTTATTATCCACATAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-947s1c1
Sequence:CCGGCCCACGTCTGAGAATCAACAACTCGAGTTGTTGATTCTCAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003379
EZR MISSION shRNA Lentiviral Transduction Particles
ezrin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380495    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003379.4-2179s21c1
Sequence:GTACCGGGGCCTGATTCTCGCGATTATTCTCGAGAATAATCGCGAGAATCAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-1070s21c1
Sequence:GTACCGGGGGCAACCATGAGTTGTATATCTCGAGATATACAACTCATGGTTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-875s21c1
Sequence:GTACCGGTGATGCCCTTGGACTGAATATCTCGAGATATTCAGTCCAAGGGCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003379.4-752s21c1
Sequence:GTACCGGCCGTGGGATGCTCAAAGATAACTCGAGTTATCTTTGAGCATCCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-194s1c1
Sequence:CCGGCCAGCCAAATACAACTGGAAACTCGAGTTTCCAGTTGTATTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-725s1c1
Sequence:CCGGCCTGGAAATGTATGGAATCAACTCGAGTTGATTCCATACATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-672s1c1
Sequence:CCGGCGTGGGATGCTCAAAGATAATCTCGAGATTATCTTTGAGCATCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-273s1c1
Sequence:CCGGCTCCACTATGTGGATAATAAACTCGAGTTTATTATCCACATAGTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003379.3-947s1c1
Sequence:CCGGCCCACGTCTGAGAATCAACAACTCGAGTTGTTGATTCTCAGACGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks