EMAIL THIS PAGE TO A FRIEND

F10

coagulation factor X

86 Gene Product Result for
Synonyms: FX FXA
UniProtKB ID: P00742, Q14340
Gene ID:
Human(2159) Summary: This gene encodes the vitamin K-dependent coagulation factor X of the blood coagulation cascade. This factor undergoes multiple processing steps before its preproprotein is converted to a mature two-chain form by the excision of the tripeptide RKR. Two chains of the factor are held together by 1 or more disulfide bonds; the light chain contains 2 EGF-like domains, while the heavy chain contains the catalytic domain which is structurally homologous to those of the other hemostatic serine proteases. The mature factor is activated by the cleavage of the activation peptide by factor IXa (in the intrisic pathway), or by factor VIIa (in the extrinsic pathway). The activated factor then converts prothrombin to thrombin in the presence of factor Va, Ca+2, and phospholipid during blood clotting. Mutations of this gene result in factor X deficiency, a hemorrhagic condition of variable severity. [provided by RefSeq, Jul 2008]
Mouse(14058) coagulation factor X
Rat(29243) coagulation factor X
Zebrafish(282670) coagulation factor X
domestic cat(101098029) coagulation factor X
cow(280787) coagulation factor X
cow(790178) coagulation factor X-like
dog(476993) coagulation factor X
chicken(395876) coagulation factor X
sheep(101118624) coagulation factor X
Domestic Rabbit(100008647) coagulation factor X
naked mole-rat(101706544) coagulation factor X
domestic guinea pig(100726878) coagulation factor X
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000504 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000504 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000504 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007972 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007972 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007972 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000504 Rosetta Predictions human pricing
NM_017143 Rosetta Predictions rat pricing
NM_007972 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179611 predicted 1211
2 SASI_Hs01_00179612 predicted 847
3 SASI_Hs01_00179613 predicted 634
4 SASI_Hs01_00179614 predicted 427
5 SASI_Hs01_00179615 predicted 825
6 SASI_Hs01_00179616 predicted 418
7 SASI_Hs01_00179617 predicted 276
8 SASI_Hs02_00302683 predicted 979
9 SASI_Hs02_00302684 predicted 647
10 SASI_Hs02_00302685 predicted 200
11 SASI_Hs01_00179610 predicted 1245
12 SASI_Hs01_00179618 predicted 1228
13 SASI_Hs01_00179619 predicted 997
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017143 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043327 predicted 677
2 SASI_Rn01_00043328 predicted 1283
3 SASI_Rn01_00043330 predicted 765
4 SASI_Rn01_00043331 predicted 700
5 SASI_Rn01_00043333 predicted 457
6 SASI_Rn01_00043334 predicted 804
7 SASI_Rn01_00043335 predicted 1308
8 SASI_Rn01_00043336 predicted 733
9 SASI_Rn02_00261400 predicted 1007
10 SASI_Rn02_00261401 predicted 776
11 SASI_Rn01_00043329 predicted 846
12 SASI_Rn01_00043332 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007972 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187300 predicted 488
2 SASI_Mm02_00312865 predicted 1756
3 SASI_Mm01_00187301 predicted 442
4 SASI_Mm02_00312866 predicted 621
5 SASI_Mm01_00187302 predicted 530
6 SASI_Mm02_00312867 predicted 844
7 SASI_Mm01_00187303 predicted 1466
8 SASI_Mm02_00312868 predicted 1040
9 SASI_Mm01_00187304 predicted 490
10 SASI_Mm02_00312869 predicted 463
11 SASI_Mm01_00187298 predicted 810
12 SASI_Mm01_00187299 predicted 563
13 SASI_Mm01_00187305 predicted 1021
14 SASI_Mm01_00187306 predicted 554
15 SASI_Mm01_00187307 predicted 465
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000504
F10 MISSION shRNA Bacterial Glycerol Stock
coagulation factor X
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-143s1c1
Sequence:CCGGAGGGCCAATTCCTTTCTTGAACTCGAGTTCAAGAAAGGAATTGGCCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-821s1c1
Sequence:CCGGCTGAGCGAGTTCTACATCCTACTCGAGTAGGATGTAGAACTCGCTCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-351s1c1
Sequence:CCGGCCTGCACCTGTTTAGAAGGATCTCGAGATCCTTCTAAACAGGTGCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-244s1c1
Sequence:CCGGCAGCGACAAGACGAATGAATTCTCGAGAATTCATTCGTCTTGTCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-1232s21c1
Sequence:CCGGTGTCCAGCAGCTTCATCATCACTCGAGTGATGATGAAGCTGCTGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-201s21c1
Sequence:CCGGGAAGAAAGGACACCTCGAAAGCTCGAGCTTTCGAGGTGTCCTTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000504
F10 MISSION shRNA shRNA Plasmid DNA
coagulation factor X
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-143s1c1
Sequence:CCGGAGGGCCAATTCCTTTCTTGAACTCGAGTTCAAGAAAGGAATTGGCCCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-821s1c1
Sequence:CCGGCTGAGCGAGTTCTACATCCTACTCGAGTAGGATGTAGAACTCGCTCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-351s1c1
Sequence:CCGGCCTGCACCTGTTTAGAAGGATCTCGAGATCCTTCTAAACAGGTGCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-244s1c1
Sequence:CCGGCAGCGACAAGACGAATGAATTCTCGAGAATTCATTCGTCTTGTCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-1232s21c1
Sequence:CCGGTGTCCAGCAGCTTCATCATCACTCGAGTGATGATGAAGCTGCTGGACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-201s21c1
Sequence:CCGGGAAGAAAGGACACCTCGAAAGCTCGAGCTTTCGAGGTGTCCTTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000504
F10 MISSION shRNA Lentiviral Transduction Particles
coagulation factor X
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-143s1c1
Sequence:CCGGAGGGCCAATTCCTTTCTTGAACTCGAGTTCAAGAAAGGAATTGGCCCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-821s1c1
Sequence:CCGGCTGAGCGAGTTCTACATCCTACTCGAGTAGGATGTAGAACTCGCTCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006791    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-351s1c1
Sequence:CCGGCCTGCACCTGTTTAGAAGGATCTCGAGATCCTTCTAAACAGGTGCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000504.2-244s1c1
Sequence:CCGGCAGCGACAAGACGAATGAATTCTCGAGAATTCATTCGTCTTGTCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-1232s21c1
Sequence:CCGGTGTCCAGCAGCTTCATCATCACTCGAGTGATGATGAAGCTGCTGGACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000504.3-201s21c1
Sequence:CCGGGAAGAAAGGACACCTCGAAAGCTCGAGCTTTCGAGGTGTCCTTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007972
F10 MISSION shRNA Bacterial Glycerol Stock
coagulation factor X
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1303s1c1
Sequence:CCGGCGTGGTCATTAAGCACAACAACTCGAGTTGTTGTGCTTAATGACCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-452s1c1
Sequence:CCGGCCTGGGAAAGGTGTGTTTATTCTCGAGAATAAACACACCTTTCCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1501s1c1
Sequence:CCGGCCAGTCGAACATCCTGAAGATCTCGAGATCTTCAGGATGTTCGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1720s1c1
Sequence:CCGGGAAAGGGAAATATGGCATCTACTCGAGTAGATGCCATATTTCCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-624s1c1
Sequence:CCGGCGAAAGAATACTGGACCAAATCTCGAGATTTGGTCCAGTATTCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007972.3-1831s21c1
Sequence:CCGGTCCCTTGACTTCATGGTATACCTCGAGGTATACCATGAAGTCAAGGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007972.3-721s21c1
Sequence:CCGGGCGGTTACTTCCTGGGTAATGCTCGAGCATTACCCAGGAAGTAACCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007972
F10 MISSION shRNA shRNA Plasmid DNA
coagulation factor X
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1303s1c1
Sequence:CCGGCGTGGTCATTAAGCACAACAACTCGAGTTGTTGTGCTTAATGACCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-452s1c1
Sequence:CCGGCCTGGGAAAGGTGTGTTTATTCTCGAGAATAAACACACCTTTCCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1501s1c1
Sequence:CCGGCCAGTCGAACATCCTGAAGATCTCGAGATCTTCAGGATGTTCGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1720s1c1
Sequence:CCGGGAAAGGGAAATATGGCATCTACTCGAGTAGATGCCATATTTCCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-624s1c1
Sequence:CCGGCGAAAGAATACTGGACCAAATCTCGAGATTTGGTCCAGTATTCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007972.3-1831s21c1
Sequence:CCGGTCCCTTGACTTCATGGTATACCTCGAGGTATACCATGAAGTCAAGGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007972.3-721s21c1
Sequence:CCGGGCGGTTACTTCCTGGGTAATGCTCGAGCATTACCCAGGAAGTAACCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007972
F10 MISSION shRNA Lentiviral Transduction Particles
coagulation factor X
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1303s1c1
Sequence:CCGGCGTGGTCATTAAGCACAACAACTCGAGTTGTTGTGCTTAATGACCACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-452s1c1
Sequence:CCGGCCTGGGAAAGGTGTGTTTATTCTCGAGAATAAACACACCTTTCCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1501s1c1
Sequence:CCGGCCAGTCGAACATCCTGAAGATCTCGAGATCTTCAGGATGTTCGACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-1720s1c1
Sequence:CCGGGAAAGGGAAATATGGCATCTACTCGAGTAGATGCCATATTTCCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007972.2-624s1c1
Sequence:CCGGCGAAAGAATACTGGACCAAATCTCGAGATTTGGTCCAGTATTCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435854    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007972.3-1831s21c1
Sequence:CCGGTCCCTTGACTTCATGGTATACCTCGAGGTATACCATGAAGTCAAGGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007972.3-721s21c1
Sequence:CCGGGCGGTTACTTCCTGGGTAATGCTCGAGCATTACCCAGGAAGTAACCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)