EMAIL THIS PAGE TO A FRIEND

F11

coagulation factor XI

85 Gene Product Result for
Synonyms: FXI
UniProtKB ID: P03951, D3DP64, Q4W5C2, Q9Y495
Gene ID:
Human(2160) Summary: This gene encodes coagulation factor XI of the blood coagulation cascade. This protein is present in plasma as a zymogen, which is a unique plasma coagulation enzyme because it exists as a homodimer consisting of two identical polypeptide chains linked by disulfide bonds. During activation of the plasma factor XI, an internal peptide bond is cleaved by factor XIIa (or XII) in each of the two chains, resulting in activated factor XIa, a serine protease composed of two heavy and two light chains held together by disulfide bonds. This activated plasma factor XI triggers the middle phase of the intrisic pathway of blood coagulation by activating factor IX. Defects in this factor lead to Rosenthal syndrome, a blood coagulation abnormality. [provided by RefSeq, Jul 2008]
Mouse(109821) coagulation factor XI
Rat(290757) coagulation factor XI
chicken(422723) coagulation factor XI
cow(407998) coagulation factor XI
domestic cat(101094340) coagulation factor XI
domestic cat(493756) coagulation factor XI
Horse(100056603) coagulation factor XI
dog(475623) coagulation factor XI
domestic guinea pig(100715511) coagulation factor XI
naked mole-rat(101717554) coagulation factor XI
sheep(101116630) coagulation factor XI
Domestic Rabbit(100009596) coagulation factor XI
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000128 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000128 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000128 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028066 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028066 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028066 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092081 MISSION® esiRNA esiRNA human F11 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000128 Rosetta Predictions human pricing
NM_019559 Rosetta Predictions human pricing
NM_001047848 Rosetta Predictions rat pricing
NM_028066 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000128 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019912 predicted 1761
2 SASI_Hs02_00301927 predicted 475
3 SASI_Hs02_00301928 predicted 914
4 SASI_Hs01_00019913 predicted 1808
5 SASI_Hs01_00019915 predicted 430
6 SASI_Hs02_00301929 predicted 853
7 SASI_Hs02_00301930 predicted 692
8 SASI_Hs02_00301931 predicted 684
9 SASI_Hs01_00019917 predicted 1847
10 SASI_Hs01_00019918 predicted 1820
11 SASI_Hs01_00019914 predicted 1810
12 SASI_Hs01_00019916 predicted 1088
13 SASI_Hs01_00019919 predicted 1683
14 SASI_Hs01_00019920 predicted 1202
15 SASI_Hs01_00019921 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128786 predicted 1449
2 SASI_Hs01_00128787 predicted 1487
3 SASI_Hs01_00128788 predicted 1656
4 SASI_Hs01_00128789 predicted 268
5 SASI_Hs01_00128790 predicted 931
6 SASI_Hs01_00128791 predicted 1528
7 SASI_Hs01_00128792 predicted 1501
8 SASI_Hs01_00128793 predicted 1515
9 SASI_Hs01_00128794 predicted 1048
10 SASI_Hs01_00128795 predicted 1109
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206155 predicted 531
2 SASI_Rn02_00206156 predicted 1358
3 SASI_Rn02_00206157 predicted 1309
4 SASI_Rn02_00206158 predicted 1188
5 SASI_Rn02_00206159 predicted 986
6 SASI_Rn02_00206160 predicted 256
7 SASI_Rn02_00206161 predicted 1312
8 SASI_Rn02_00206162 predicted 1285
9 SASI_Rn02_00206163 predicted 366
10 SASI_Rn02_00206164 predicted 340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028066 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021824 predicted 1410
2 SASI_Mm01_00021825 predicted 1551
3 SASI_Mm01_00021826 predicted 1123
4 SASI_Mm01_00021827 predicted 679
5 SASI_Mm01_00021828 predicted 447
6 SASI_Mm01_00021829 predicted 1958
7 SASI_Mm01_00021830 predicted 1998
8 SASI_Mm01_00021831 predicted 863
9 SASI_Mm01_00021832 predicted 1965
10 SASI_Mm02_00333269 predicted 1717
11 SASI_Mm01_00021833 predicted 1659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000128
F11 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XI
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-685s21c1
Sequence:CCGGCTAGACATGAAGGGCATAAACCTCGAGGTTTATGCCCTTCATGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-862s21c1
Sequence:CCGGAGAATAACGAAGCTCGATAAACTCGAGTTTATCGAGCTTCGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-1123s21c1
Sequence:CCGGTTGCCCAGTACACGCATTAAACTCGAGTTTAATGCGTGTACTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000128.2-2066s1c1
Sequence:CCGGGCCATTGGAGTCCCTGAAGGACTCGAGTCCTTCAGGGACTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-329s1c1
Sequence:CCGGCCACCCAAGATGTTTACTCTTCTCGAGAAGAGTAAACATCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1676s1c1
Sequence:CCGGGCCTTCCAAAGGAGATAGAAACTCGAGTTTCTATCTCCTTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-911s1c1
Sequence:CCGGGCCCAAAGAATCTCAAAGAAACTCGAGTTTCTTTGAGATTCTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1604s1c1
Sequence:CCGGCGGGTATGATATTGCCTTGTTCTCGAGAACAAGGCAATATCATACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000128
F11 MISSION shRNA shRNA Plasmid DNA
coagulation factor XI
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-685s21c1
Sequence:CCGGCTAGACATGAAGGGCATAAACCTCGAGGTTTATGCCCTTCATGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-862s21c1
Sequence:CCGGAGAATAACGAAGCTCGATAAACTCGAGTTTATCGAGCTTCGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-1123s21c1
Sequence:CCGGTTGCCCAGTACACGCATTAAACTCGAGTTTAATGCGTGTACTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000128.2-2066s1c1
Sequence:CCGGGCCATTGGAGTCCCTGAAGGACTCGAGTCCTTCAGGGACTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-329s1c1
Sequence:CCGGCCACCCAAGATGTTTACTCTTCTCGAGAAGAGTAAACATCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1676s1c1
Sequence:CCGGGCCTTCCAAAGGAGATAGAAACTCGAGTTTCTATCTCCTTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-911s1c1
Sequence:CCGGGCCCAAAGAATCTCAAAGAAACTCGAGTTTCTTTGAGATTCTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1604s1c1
Sequence:CCGGCGGGTATGATATTGCCTTGTTCTCGAGAACAAGGCAATATCATACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000128
F11 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XI
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-685s21c1
Sequence:CCGGCTAGACATGAAGGGCATAAACCTCGAGGTTTATGCCCTTCATGTCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-862s21c1
Sequence:CCGGAGAATAACGAAGCTCGATAAACTCGAGTTTATCGAGCTTCGTTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372203    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000128.3-1123s21c1
Sequence:CCGGTTGCCCAGTACACGCATTAAACTCGAGTTTAATGCGTGTACTGGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006792    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000128.2-2066s1c1
Sequence:CCGGGCCATTGGAGTCCCTGAAGGACTCGAGTCCTTCAGGGACTCCAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006793    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-329s1c1
Sequence:CCGGCCACCCAAGATGTTTACTCTTCTCGAGAAGAGTAAACATCTTGGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1676s1c1
Sequence:CCGGGCCTTCCAAAGGAGATAGAAACTCGAGTTTCTATCTCCTTTGGAAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-911s1c1
Sequence:CCGGGCCCAAAGAATCTCAAAGAAACTCGAGTTTCTTTGAGATTCTTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000128.2-1604s1c1
Sequence:CCGGCGGGTATGATATTGCCTTGTTCTCGAGAACAAGGCAATATCATACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028066
F11 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XI
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028066.1-1995s1c1
Sequence:CCGGGCCCTGGAAGATTATTCCATACTCGAGTATGGAATAATCTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1465s1c1
Sequence:CCGGGCTTTCTTCAGGGTTCAAGAACTCGAGTTCTTGAACCCTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1694s1c1
Sequence:CCGGCCAAGGTTCCATTGGTGTCAACTCGAGTTGACACCAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-869s1c1
Sequence:CCGGCCTCTGAAAGTGGATTACCAACTCGAGTTGGTAATCCACTTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-444s1c1
Sequence:CCGGCCTAGACATGAAGGGCATGAACTCGAGTTCATGCCCTTCATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028066
F11 MISSION shRNA shRNA Plasmid DNA
coagulation factor XI
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028066.1-1995s1c1
Sequence:CCGGGCCCTGGAAGATTATTCCATACTCGAGTATGGAATAATCTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1465s1c1
Sequence:CCGGGCTTTCTTCAGGGTTCAAGAACTCGAGTTCTTGAACCCTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1694s1c1
Sequence:CCGGCCAAGGTTCCATTGGTGTCAACTCGAGTTGACACCAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-869s1c1
Sequence:CCGGCCTCTGAAAGTGGATTACCAACTCGAGTTGGTAATCCACTTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-444s1c1
Sequence:CCGGCCTAGACATGAAGGGCATGAACTCGAGTTCATGCCCTTCATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028066
F11 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XI
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086698    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028066.1-1995s1c1
Sequence:CCGGGCCCTGGAAGATTATTCCATACTCGAGTATGGAATAATCTTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1465s1c1
Sequence:CCGGGCTTTCTTCAGGGTTCAAGAACTCGAGTTCTTGAACCCTGAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-1694s1c1
Sequence:CCGGCCAAGGTTCCATTGGTGTCAACTCGAGTTGACACCAATGGAACCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-869s1c1
Sequence:CCGGCCTCTGAAAGTGGATTACCAACTCGAGTTGGTAATCCACTTTCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028066.1-444s1c1
Sequence:CCGGCCTAGACATGAAGGGCATGAACTCGAGTTCATGCCCTTCATGTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks