EMAIL THIS PAGE TO A FRIEND

F11R

F11 receptor

Synonyms: CD321 JAM JAM1 JAMA JCAM KAT PAM-1
UniProtKB ID: Q9Y624
Gene ID:
Human(50848) Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. The protein encoded by this immunoglobulin superfamily gene member is an important regulator of tight junction assembly in epithelia. In addition, the encoded protein can act as (1) a receptor for reovirus, (2) a ligand for the integrin LFA1, involved in leukocyte transmigration, and (3) a platelet receptor. Multiple 5' alternatively spliced variants, encoding the same protein, have been identified but their biological validity has not been established. [provided by RefSeq, Jul 2008]
Mouse(16456) F11 receptor
Rat(116479) F11 receptor
Zebrafish(323696) F11 receptor
dog(478974) F11 receptor
cow(281258) F11 receptor
domestic cat(653015) F11 receptor
chicken(100036512) F11 receptor
sheep(780487) F11 receptor
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016946 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016946 Rosetta Predictions human pricing
NM_144502 Rosetta Predictions human pricing
NM_144503 Rosetta Predictions human pricing
NM_144504 Rosetta Predictions human pricing
NM_053796 Rosetta Predictions rat pricing
NM_172647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049784 predicted 1256
2 SASI_Hs01_00049786 predicted 1093
3 SASI_Hs01_00049787 predicted 1087
4 SASI_Hs02_00349948 predicted 292
5 SASI_Hs02_00349949 predicted 292
6 SASI_Hs01_00049790 predicted 777
7 SASI_Hs02_00349950 predicted 657
8 SASI_Hs01_00049792 predicted 770
9 SASI_Hs01_00049793 predicted 765
10 SASI_Hs02_00349951 predicted 825
11 SASI_Hs01_00049785 predicted 1262
12 SASI_Hs01_00049788 predicted 1243
13 SASI_Hs01_00049789 predicted 1263
14 SASI_Hs01_00049791 predicted 1235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103467 predicted 943
2 SASI_Hs01_00103468 predicted 1137
3 SASI_Hs01_00103469 predicted 786
4 SASI_Hs01_00103470 predicted 766
5 SASI_Hs01_00103471 predicted 1125
6 SASI_Hs01_00103472 predicted 1143
7 SASI_Hs01_00103473 predicted 462
8 SASI_Hs01_00103474 predicted 1114
9 SASI_Hs01_00103475 predicted 458
10 SASI_Hs01_00103476 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144503 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055822 predicted 1270
2 SASI_Hs01_00055823 predicted 1469
3 SASI_Hs01_00055824 predicted 1111
4 SASI_Hs01_00055825 predicted 1102
5 SASI_Hs01_00055826 predicted 1460
6 SASI_Hs01_00055827 predicted 1466
7 SASI_Hs01_00055828 predicted 797
8 SASI_Hs01_00055829 predicted 1441
9 SASI_Hs01_00055830 predicted 786
10 SASI_Hs01_00055831 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144504 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186567 predicted 1209
2 SASI_Hs01_00186568 predicted 1398
3 SASI_Hs01_00186569 predicted 1048
4 SASI_Hs01_00186570 predicted 1031
5 SASI_Hs01_00186571 predicted 1389
6 SASI_Hs01_00186572 predicted 1403
7 SASI_Hs01_00186573 predicted 726
8 SASI_Hs01_00186574 predicted 1379
9 SASI_Hs01_00186575 predicted 719
10 SASI_Hs01_00186576 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053796 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090623 predicted 371
2 SASI_Rn01_00090624 predicted 681
3 SASI_Rn01_00090625 predicted 981
4 SASI_Rn01_00090626 predicted 1252
5 SASI_Rn01_00090627 predicted 628
6 SASI_Rn01_00090628 predicted 202
7 SASI_Rn01_00090629 predicted 808
8 SASI_Rn01_00090630 predicted 375
9 SASI_Rn01_00090631 predicted 209
10 SASI_Rn01_00090632 predicted 1184
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00107016 predicted 1110
2 SASI_Mm02_00344361 predicted 1446
3 SASI_Mm01_00107017 predicted 386
4 SASI_Mm01_00107018 predicted 638
5 SASI_Mm01_00107019 predicted 582
6 SASI_Mm01_00107020 predicted 1059
7 SASI_Mm01_00107021 predicted 1260
8 SASI_Mm01_00107022 predicted 1317
9 SASI_Mm01_00107023 predicted 1260
10 SASI_Mm01_00107024 predicted 869
11 SASI_Mm01_00107025 predicted 1310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016946
VALIDATED
F11R MISSION shRNA Bacterial Glycerol Stock
F11 receptor
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000061649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-279s1c1
Sequence:CCGGCCAGACTCGTTTGCTATAATACTCGAGTATTATAGCAAACGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-862s1c1
Sequence:CCGGCCACTTTGACAGAACAAAGAACTCGAGTTCTTTGTTCTGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-150s1c1
Sequence:CCGGGCAGTGTTACAGTGCACTCTTCTCGAGAAGAGTGCACTGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000061652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016946.3-340s1c1
Sequence:CCGGGCCAACTGGTATCACCTTCAACTCGAGTTGAAGGTGATACCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016946.4-1246s21c1
Sequence:CCGGAGTTTCACAGGATGCCTTATTCTCGAGAATAAGGCATCCTGTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-925s21c1
Sequence:CCGGGGGACACCCATGACTTCAAATCTCGAGATTTGAAGTCATGGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-879s21c1
Sequence:CCGGAGCCTCTGATACTGGAGAATACTCGAGTATTCTCCAGTATCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-848s21c1
Sequence:CCGGCAACAGGAGAGCTGGTCTTTGCTCGAGCAAAGACCAGCTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-663s21c1
Sequence:CCGGTCCATCCAAGCCTACAGTTAACTCGAGTTAACTGTAGGCTTGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016946
VALIDATED
F11R MISSION shRNA shRNA Plasmid DNA
F11 receptor
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000061649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-279s1c1
Sequence:CCGGCCAGACTCGTTTGCTATAATACTCGAGTATTATAGCAAACGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-862s1c1
Sequence:CCGGCCACTTTGACAGAACAAAGAACTCGAGTTCTTTGTTCTGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-150s1c1
Sequence:CCGGGCAGTGTTACAGTGCACTCTTCTCGAGAAGAGTGCACTGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000061652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016946.3-340s1c1
Sequence:CCGGGCCAACTGGTATCACCTTCAACTCGAGTTGAAGGTGATACCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016946.4-1246s21c1
Sequence:CCGGAGTTTCACAGGATGCCTTATTCTCGAGAATAAGGCATCCTGTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-925s21c1
Sequence:CCGGGGGACACCCATGACTTCAAATCTCGAGATTTGAAGTCATGGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-879s21c1
Sequence:CCGGAGCCTCTGATACTGGAGAATACTCGAGTATTCTCCAGTATCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-848s21c1
Sequence:CCGGCAACAGGAGAGCTGGTCTTTGCTCGAGCAAAGACCAGCTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-663s21c1
Sequence:CCGGTCCATCCAAGCCTACAGTTAACTCGAGTTAACTGTAGGCTTGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016946
VALIDATED
F11R MISSION shRNA Lentiviral Transduction Particles
F11 receptor
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000061649    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-279s1c1
Sequence:CCGGCCAGACTCGTTTGCTATAATACTCGAGTATTATAGCAAACGAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-862s1c1
Sequence:CCGGCCACTTTGACAGAACAAAGAACTCGAGTTCTTTGTTCTGTCAAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061651    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_016946.3-150s1c1
Sequence:CCGGGCAGTGTTACAGTGCACTCTTCTCGAGAAGAGTGCACTGTAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000061652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016946.3-340s1c1
Sequence:CCGGGCCAACTGGTATCACCTTCAACTCGAGTTGAAGGTGATACCAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431967    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016946.4-1246s21c1
Sequence:CCGGAGTTTCACAGGATGCCTTATTCTCGAGAATAAGGCATCCTGTGAAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-925s21c1
Sequence:CCGGGGGACACCCATGACTTCAAATCTCGAGATTTGAAGTCATGGGTGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-879s21c1
Sequence:CCGGAGCCTCTGATACTGGAGAATACTCGAGTATTCTCCAGTATCAGAGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-848s21c1
Sequence:CCGGCAACAGGAGAGCTGGTCTTTGCTCGAGCAAAGACCAGCTCTCCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016946.4-663s21c1
Sequence:CCGGTCCATCCAAGCCTACAGTTAACTCGAGTTAACTGTAGGCTTGGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172647
VALIDATED
F11R MISSION shRNA Bacterial Glycerol Stock
F11 receptor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172647.1-200s1c1
Sequence:CCGGCCGAGAACGAGTCCATCAAATCTCGAGATTTGATGGACTCGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-859s21c1
Sequence:CCGGCCTATAGCCGTGGATACTTTGCTCGAGCAAAGTATCCACGGCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-901s21c1
Sequence:CCGGCACCGGGTAAGAAGGTCATTTCTCGAGAAATGACCTTCTTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-164s21c1
Sequence:CCGGTTCGGTGTACACTGCTCAATCCTCGAGGATTGAGCAGTGTACACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-571s21c1
Sequence:CCGGCCTGGTTCAAGGACGGGATATCTCGAGATATCCCGTCCTTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172647.2-1995s21c1
Sequence:CCGGGCTGATTCCCAGGACTATATTCTCGAGAATATAGTCCTGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172647
VALIDATED
F11R MISSION shRNA shRNA Plasmid DNA
F11 receptor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172647.1-200s1c1
Sequence:CCGGCCGAGAACGAGTCCATCAAATCTCGAGATTTGATGGACTCGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-859s21c1
Sequence:CCGGCCTATAGCCGTGGATACTTTGCTCGAGCAAAGTATCCACGGCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-901s21c1
Sequence:CCGGCACCGGGTAAGAAGGTCATTTCTCGAGAAATGACCTTCTTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-164s21c1
Sequence:CCGGTTCGGTGTACACTGCTCAATCCTCGAGGATTGAGCAGTGTACACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-571s21c1
Sequence:CCGGCCTGGTTCAAGGACGGGATATCTCGAGATATCCCGTCCTTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172647.2-1995s21c1
Sequence:CCGGGCTGATTCCCAGGACTATATTCTCGAGAATATAGTCCTGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172647
VALIDATED
F11R MISSION shRNA Lentiviral Transduction Particles
F11 receptor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172647.1-200s1c1
Sequence:CCGGCCGAGAACGAGTCCATCAAATCTCGAGATTTGATGGACTCGTTCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271794    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-859s21c1
Sequence:CCGGCCTATAGCCGTGGATACTTTGCTCGAGCAAAGTATCCACGGCTATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271792    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-901s21c1
Sequence:CCGGCACCGGGTAAGAAGGTCATTTCTCGAGAAATGACCTTCTTACCCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-164s21c1
Sequence:CCGGTTCGGTGTACACTGCTCAATCCTCGAGGATTGAGCAGTGTACACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271840    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172647.2-571s21c1
Sequence:CCGGCCTGGTTCAAGGACGGGATATCTCGAGATATCCCGTCCTTGAACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284518    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172647.2-1995s21c1
Sequence:CCGGGCTGATTCCCAGGACTATATTCTCGAGAATATAGTCCTGGGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks