EMAIL THIS PAGE TO A FRIEND

F12

coagulation factor XII (Hageman factor)

50 Gene Product Result for
Synonyms: HAE3 HAEX HAF
UniProtKB ID: P00748, P78339
Gene ID:
Human(2161) Summary: This gene encodes coagulation factor XII which circulates in blood as a zymogen. This single chain zymogen is converted to a two-chain serine protease with an heavy chain (alpha-factor XIIa) and a light chain. The heavy chain contains two fibronectin-type domains, two epidermal growth factor (EGF)-like domains, a kringle domain and a proline-rich domain, whereas the light chain contains only a catalytic domain. On activation, further cleavages takes place in the heavy chain, resulting in the production of beta-factor XIIa light chain and the alpha-factor XIIa light chain becomes beta-factor XIIa heavy chain. Prekallikrein is cleaved by factor XII to form kallikrein, which then cleaves factor XII first to alpha-factor XIIa and then to beta-factor XIIa. The active factor XIIa participates in the initiation of blood coagulation, fibrinolysis, and the generation of bradykinin and angiotensin. It activates coagulation factors VII and XI. Defects in this gene do not cause any clinical symptoms and the sole effect is that whole-blood clotting time is prolonged. [provided by RefSeq, Jul 2008]
Mouse(58992) coagulation factor XII (Hageman factor)
Rat(306761) coagulation factor XII (Hageman factor)
dog(489090) coagulation factor XII (Hageman factor)
Horse(100068589) coagulation factor XII (Hageman factor)
cow(280789) coagulation factor XII (Hageman factor)
domestic cat(100313488) coagulation factor XII (Hageman factor)
domestic guinea pig(100728720) coagulation factor XII (Hageman factor)
naked mole-rat(101720589) coagulation factor XII (Hageman factor)
sheep(101106770) coagulation factor XII (Hageman factor)
Domestic Rabbit(100351481) coagulation factor XII (Hageman factor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000505 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000505 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000505 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021489 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021489 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021489 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000505 Rosetta Predictions human pricing
NM_001014006 Rosetta Predictions rat pricing
NM_021489 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000505 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034925 predicted 1403
2 SASI_Hs01_00034926 predicted 303
3 SASI_Hs01_00034927 predicted 785
4 SASI_Hs01_00034928 predicted 209
5 SASI_Hs01_00034929 predicted 1135
6 SASI_Hs01_00034931 predicted 322
7 SASI_Hs01_00034932 predicted 975
8 SASI_Hs01_00034933 predicted 830
9 SASI_Hs01_00034934 predicted 674
10 SASI_Hs02_00302686 predicted 412
11 SASI_Hs01_00034930 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014006 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106771 predicted 944
2 SASI_Rn01_00106772 predicted 1188
3 SASI_Rn02_00201376 predicted 637
4 SASI_Rn01_00106774 predicted 562
5 SASI_Rn01_00106775 predicted 1322
6 SASI_Rn01_00106776 predicted 826
7 SASI_Rn01_00106777 predicted 1767
8 SASI_Rn01_00106778 predicted 230
9 SASI_Rn01_00106779 predicted 1461
10 SASI_Rn01_00106780 predicted 478
11 SASI_Rn01_00106773 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021489 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00194410 predicted 1402
2 SASI_Mm01_00194411 predicted 627
3 SASI_Mm01_00194412 predicted 844
4 SASI_Mm02_00326182 predicted 452
5 SASI_Mm01_00194414 predicted 1560
6 SASI_Mm01_00194415 predicted 1008
7 SASI_Mm01_00194416 predicted 1601
8 SASI_Mm01_00194417 predicted 417
9 SASI_Mm01_00194418 predicted 836
10 SASI_Mm02_00326183 predicted 304
11 SASI_Mm01_00194409 predicted 503
12 SASI_Mm01_00194413 predicted 1453
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000505
F12 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XII (Hageman factor)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-426s21c1
Sequence:CCGGCTGGAAACCACTGCCAGAAAGCTCGAGCTTTCTGGCAGTGGTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-315s21c1
Sequence:CCGGTGGAGCCCAAGAAAGTGAAAGCTCGAGCTTTCACTTTCTTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-131s1c1
Sequence:CCGGGAGCATAAGTACAAAGCTGAACTCGAGTTCAGCTTTGTACTTATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-220s1c1
Sequence:CCGGGTACCACAAATGTACCCACAACTCGAGTTGTGGGTACATTTGTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-83s1c1
Sequence:CCGGGTGAGCTTGGAGTCAACACTTCTCGAGAAGTGTTGACTCCAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-1138s1c1
Sequence:CCGGCCGCAAGAGTCTGTCTTCGATCTCGAGATCGAAGACAGACTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-482s1c1
Sequence:CCGGCACAAGAATGAGATATGGTATCTCGAGATACCATATCTCATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000505
F12 MISSION shRNA shRNA Plasmid DNA
coagulation factor XII (Hageman factor)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-426s21c1
Sequence:CCGGCTGGAAACCACTGCCAGAAAGCTCGAGCTTTCTGGCAGTGGTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-315s21c1
Sequence:CCGGTGGAGCCCAAGAAAGTGAAAGCTCGAGCTTTCACTTTCTTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-131s1c1
Sequence:CCGGGAGCATAAGTACAAAGCTGAACTCGAGTTCAGCTTTGTACTTATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-220s1c1
Sequence:CCGGGTACCACAAATGTACCCACAACTCGAGTTGTGGGTACATTTGTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-83s1c1
Sequence:CCGGGTGAGCTTGGAGTCAACACTTCTCGAGAAGTGTTGACTCCAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-1138s1c1
Sequence:CCGGCCGCAAGAGTCTGTCTTCGATCTCGAGATCGAAGACAGACTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-482s1c1
Sequence:CCGGCACAAGAATGAGATATGGTATCTCGAGATACCATATCTCATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000505
F12 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XII (Hageman factor)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-426s21c1
Sequence:CCGGCTGGAAACCACTGCCAGAAAGCTCGAGCTTTCTGGCAGTGGTTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000505.3-315s21c1
Sequence:CCGGTGGAGCCCAAGAAAGTGAAAGCTCGAGCTTTCACTTTCTTGGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-131s1c1
Sequence:CCGGGAGCATAAGTACAAAGCTGAACTCGAGTTCAGCTTTGTACTTATGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-220s1c1
Sequence:CCGGGTACCACAAATGTACCCACAACTCGAGTTGTGGGTACATTTGTGGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006801    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-83s1c1
Sequence:CCGGGTGAGCTTGGAGTCAACACTTCTCGAGAAGTGTTGACTCCAAGCTCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006800    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-1138s1c1
Sequence:CCGGCCGCAAGAGTCTGTCTTCGATCTCGAGATCGAAGACAGACTCTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000505.2-482s1c1
Sequence:CCGGCACAAGAATGAGATATGGTATCTCGAGATACCATATCTCATTCTTGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021489
F12 MISSION shRNA Bacterial Glycerol Stock
coagulation factor XII (Hageman factor)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-291s1c1
Sequence:CCGGCCCAAGAAAGTGAAAGACCATCTCGAGATGGTCTTTCACTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-621s1c1
Sequence:CCGGCCTACAGGCTACACTGGATATCTCGAGATATCCAGTGTAGCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-757s1c1
Sequence:CCGGCCTACCGGAACATGACTGAAACTCGAGTTTCAGTCATGTTCCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-1224s1c1
Sequence:CCGGCCCGAGGAACTGACAGTGGTACTCGAGTACCACTGTCAGTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-553s1c1
Sequence:CCGGGCAGCATCAATCCGTGCCTTACTCGAGTAAGGCACGGATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021489
F12 MISSION shRNA shRNA Plasmid DNA
coagulation factor XII (Hageman factor)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-291s1c1
Sequence:CCGGCCCAAGAAAGTGAAAGACCATCTCGAGATGGTCTTTCACTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-621s1c1
Sequence:CCGGCCTACAGGCTACACTGGATATCTCGAGATATCCAGTGTAGCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-757s1c1
Sequence:CCGGCCTACCGGAACATGACTGAAACTCGAGTTTCAGTCATGTTCCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-1224s1c1
Sequence:CCGGCCCGAGGAACTGACAGTGGTACTCGAGTACCACTGTCAGTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-553s1c1
Sequence:CCGGGCAGCATCAATCCGTGCCTTACTCGAGTAAGGCACGGATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021489
F12 MISSION shRNA Lentiviral Transduction Particles
coagulation factor XII (Hageman factor)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-291s1c1
Sequence:CCGGCCCAAGAAAGTGAAAGACCATCTCGAGATGGTCTTTCACTTTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031605    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-621s1c1
Sequence:CCGGCCTACAGGCTACACTGGATATCTCGAGATATCCAGTGTAGCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031606    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-757s1c1
Sequence:CCGGCCTACCGGAACATGACTGAAACTCGAGTTTCAGTCATGTTCCGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-1224s1c1
Sequence:CCGGCCCGAGGAACTGACAGTGGTACTCGAGTACCACTGTCAGTTCCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021489.1-553s1c1
Sequence:CCGGGCAGCATCAATCCGTGCCTTACTCGAGTAAGGCACGGATTGATGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks